| Sequence ID | dm3.chr3L |
|---|---|
| Location | 15,017,755 – 15,017,852 |
| Length | 97 |
| Max. P | 0.739114 |
| Location | 15,017,755 – 15,017,852 |
|---|---|
| Length | 97 |
| Sequences | 4 |
| Columns | 109 |
| Reading direction | reverse |
| Mean pairwise identity | 71.26 |
| Shannon entropy | 0.43178 |
| G+C content | 0.49556 |
| Mean single sequence MFE | -25.57 |
| Consensus MFE | -10.99 |
| Energy contribution | -11.80 |
| Covariance contribution | 0.81 |
| Combinations/Pair | 1.23 |
| Mean z-score | -2.19 |
| Structure conservation index | 0.43 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.55 |
| SVM RNA-class probability | 0.739114 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 15017755 97 - 24543557 UUGACAUUUUCCCCACUUUCU--------CACUUUCCAACUUAUUCAUCACAACCCCCACCCACAUUUUCCAUUUUCCUGGGUGGAU----GUGGGUGGGUUCUCCUGG .....................--------..........................(((((((((((((((((......)))).))))----)))))))))......... ( -26.20, z-score = -1.98, R) >droYak2.chr3L 15108867 76 - 24197627 AUGACAAUUUCCACUCAAC----------CACUCACCCACUUUUCCAGU-------UCCUCACCAUUUUCCAUUUUCCUGUGUGG------GUGGGUGG---------- ..................(----------(((((((((((.....(((.-------.....................))).))))------))))))))---------- ( -21.45, z-score = -2.66, R) >droSec1.super_0 7134498 104 - 21120651 UUGACAUUUUCCCCACUUUCUCACUUUCCCACUUCCCAACUUACCCACCA-----CCCCCCCACAUUUUCCAUUUUCCUGUGUGGGUGUGGGUGGGUGGGUUCUCCUGG ...................................(((....((((((((-----(((((((((((.............))))))).).)))).))))))).....))) ( -33.02, z-score = -2.43, R) >droSim1.chr3L 14338927 91 - 22553184 UUGACAUUUUCCCCACUUUCU--------CACUUCCCAACUUACCCACCA------CCCCCCACAUUUUCCAUUUUCCUGUGUGAGU----GUGGGUGGGUUCUCCUGG .....................--------...............(((..(------((((((((((((..(((......))).))))----))))).)))).....))) ( -21.60, z-score = -1.69, R) >consensus UUGACAUUUUCCCCACUUUCU________CACUUCCCAACUUACCCACCA______CCCCCCACAUUUUCCAUUUUCCUGUGUGGGU____GUGGGUGGGUUCUCCUGG .......................................................(((.(((((....(((((........))))).....))))).)))......... (-10.99 = -11.80 + 0.81)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:27:36 2011