| Sequence ID | dm3.chr3L |
|---|---|
| Location | 14,854,681 – 14,854,773 |
| Length | 92 |
| Max. P | 0.749641 |
| Location | 14,854,681 – 14,854,773 |
|---|---|
| Length | 92 |
| Sequences | 5 |
| Columns | 92 |
| Reading direction | reverse |
| Mean pairwise identity | 71.78 |
| Shannon entropy | 0.47397 |
| G+C content | 0.38971 |
| Mean single sequence MFE | -13.37 |
| Consensus MFE | -8.32 |
| Energy contribution | -8.28 |
| Covariance contribution | -0.04 |
| Combinations/Pair | 1.25 |
| Mean z-score | -1.21 |
| Structure conservation index | 0.62 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.58 |
| SVM RNA-class probability | 0.749641 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 14854681 92 - 24543557 AAUUUUCGCUCUCCGCCCAUUUUCCUUGUGGGUCCCUUCCCCUUGGAAAUUUUUAUCAAGUGCAUAAAUUAGCAUACCACACCACAUUUCUU (((((..((.((........(((((..(.(((......))))..))))).........)).))..)))))...................... ( -14.13, z-score = -1.51, R) >droEre2.scaffold_4784 14814672 72 - 25762168 --------------------UUUCCUCGUGGGUCCAUUCCUCUAGAAAAAUAUUAUCAAGUGCAUAAAUUAGCAUACCACACCGCGAUUUGC --------------------.....((((((.....(((.....)))............((((........))))......))))))..... ( -12.00, z-score = -1.18, R) >droYak2.chr3L 14938777 71 - 24197627 ---------------------UUUCCCCUGGGUCCUUUCCUCUUAAAAAAUUUUAUCAAGUGCAUAAAUUAGCACAAUUUGGUUUUUUUUUU ---------------------........(((.....)))....((((((....(((((((((........))))...)))))...)))))) ( -8.80, z-score = -0.36, R) >droSec1.super_0 6967663 92 - 21120651 CAUUUUCGCUCUCCGCCCAUUUUCCUUGUGGGUCCAUUCCUCUUGGAAAAUCUUAUCAAGUGCAUAAAUUAGCAUACCACACCAUAUUUUGU ..............((((((.......))))))...((((....))))...........((((........))))................. ( -14.30, z-score = -1.07, R) >droSim1.chr3L 14170045 92 - 22553184 CAUUUUCGCUCUCCGCCCAUUUUCCUUGUGGGUCCAUUCCCCUUGGAAAAUCUUAUCAAGUGCAUAAAUUAGCAUACCACACCGCAUUUUGU .......((.........(((((((..(.(((......))))..)))))))........((((........))))........))....... ( -17.60, z-score = -1.94, R) >consensus _AUUUUCGCUCUCCGCCCAUUUUCCUUGUGGGUCCAUUCCUCUUGGAAAAUCUUAUCAAGUGCAUAAAUUAGCAUACCACACCACAUUUUGU ....................(((((....(((......)))...)))))..........((((........))))................. ( -8.32 = -8.28 + -0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:27:03 2011