Sequence ID | dm3.chr3L |
---|---|
Location | 13,819,193 – 13,819,254 |
Length | 61 |
Max. P | 0.627768 |
Location | 13,819,193 – 13,819,254 |
---|---|
Length | 61 |
Sequences | 5 |
Columns | 62 |
Reading direction | forward |
Mean pairwise identity | 95.77 |
Shannon entropy | 0.07388 |
G+C content | 0.51301 |
Mean single sequence MFE | -17.74 |
Consensus MFE | -16.30 |
Energy contribution | -16.38 |
Covariance contribution | 0.08 |
Combinations/Pair | 1.12 |
Mean z-score | -1.40 |
Structure conservation index | 0.92 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.28 |
SVM RNA-class probability | 0.627768 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 13819193 61 + 24543557 GGAGUU-CUCUGCGUGGGCAGGGUAAAGAAUGGGUAAAGGAGAUAAGUUUUUGCGGCCCCGA ......-((((((....))))))........((((...(((((....)))))...))))... ( -15.30, z-score = -0.02, R) >droSim1.chr3L 13187777 61 + 22553184 GGAGUU-CUCUGCGUGGGCAGGGUAAAGAAUGGGUAUAGGAGAUAAGUUUUUGCGGCCCAGA ......-((((((....)))))).......(((((...(((((....)))))...))))).. ( -17.20, z-score = -1.49, R) >droSec1.super_0 5962576 61 + 21120651 GGAGUU-CUCUGCGUGGGCAGGGUAAAGAAUGGGUAUAGGAGAUAAGUUUUUGCGGCCCAGA ......-((((((....)))))).......(((((...(((((....)))))...))))).. ( -17.20, z-score = -1.49, R) >droYak2.chr3L 13901462 62 + 24197627 GGAGUUGCCCUGCGUGGGCAGGGUAAAGAAUGGGUAAAGGAGAUAAGUUUUUGCGGCCCAGA ....(((((((((....)))))))))....(((((...(((((....)))))...))))).. ( -24.40, z-score = -3.53, R) >droEre2.scaffold_4784 13807744 61 + 25762168 GGAGUU-CUCUGCGUGGGCACAGUAAAGAAUGGGUAAAGGAGAUAAGUUUUUGCGGCCCAGA ...(((-((.(((.((....))))).)))))((((...(((((....)))))...))))... ( -14.60, z-score = -0.45, R) >consensus GGAGUU_CUCUGCGUGGGCAGGGUAAAGAAUGGGUAAAGGAGAUAAGUUUUUGCGGCCCAGA .......((((((....)))))).......(((((...(((((....)))))...))))).. (-16.30 = -16.38 + 0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:24:36 2011