| Sequence ID | dm3.chr3L |
|---|---|
| Location | 13,781,265 – 13,781,316 |
| Length | 51 |
| Max. P | 0.966891 |
| Location | 13,781,265 – 13,781,316 |
|---|---|
| Length | 51 |
| Sequences | 3 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 97.39 |
| Shannon entropy | 0.03601 |
| G+C content | 0.57516 |
| Mean single sequence MFE | -9.60 |
| Consensus MFE | -9.60 |
| Energy contribution | -9.60 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.90 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.77 |
| SVM RNA-class probability | 0.966891 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 13781265 51 - 24543557 GUCGACGUGAACGUCGUCAUCGUCAUCGUCAUCAUCACCCUCACCCUCCCC (.(((((....))))).)................................. ( -9.60, z-score = -2.18, R) >droSim1.chr3L 13168450 51 - 22553184 GUCGACGUGAACGUCGUCAUCGUCAUCGUCAUCAUCAACCUCACCCUCCGC (.(((((....))))).)................................. ( -9.60, z-score = -1.33, R) >droSec1.super_0 5942845 51 - 21120651 GUCGACGUGAACGUCGUCAUCGUCAUCGUCAUCAUCAACCUCACCCUCCCC (.(((((....))))).)................................. ( -9.60, z-score = -2.17, R) >consensus GUCGACGUGAACGUCGUCAUCGUCAUCGUCAUCAUCAACCUCACCCUCCCC (.(((((....))))).)................................. ( -9.60 = -9.60 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:24:27 2011