| Sequence ID | dm3.chr3L |
|---|---|
| Location | 13,700,721 – 13,700,778 |
| Length | 57 |
| Max. P | 0.778657 |
| Location | 13,700,721 – 13,700,778 |
|---|---|
| Length | 57 |
| Sequences | 10 |
| Columns | 61 |
| Reading direction | forward |
| Mean pairwise identity | 73.05 |
| Shannon entropy | 0.55554 |
| G+C content | 0.33225 |
| Mean single sequence MFE | -10.46 |
| Consensus MFE | -3.19 |
| Energy contribution | -3.39 |
| Covariance contribution | 0.20 |
| Combinations/Pair | 1.33 |
| Mean z-score | -2.31 |
| Structure conservation index | 0.31 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.66 |
| SVM RNA-class probability | 0.778657 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 13700721 57 + 24543557 UAACGCGUAAGCAAAUAAUAAAUAAACCCCUUGUUGCGCA----AAAAAGUGCAAUAAAGU ....((....))..................(((((((((.----.....)))))))))... ( -14.10, z-score = -4.06, R) >droSim1.chr3L 13086304 57 + 22553184 UAACGCGUAAGCAAAUAAUAAAUAAACCCCUUGUUGCGCA----AAAAAGUGCAAUAAAGU ....((....))..................(((((((((.----.....)))))))))... ( -14.10, z-score = -4.06, R) >droSec1.super_0 5862788 57 + 21120651 UAACGCGUAAGCAAAUAAUAAAUAAACCCCUUGUUGCGCA----AAAAAGUGCAAUAAAGU ....((....))..................(((((((((.----.....)))))))))... ( -14.10, z-score = -4.06, R) >droYak2.chr3L 13797212 57 + 24197627 UAACGCGUAAGCAAAUAAUAAAUAAACCCCUUGUUGCGCA----AAAAAGUGCAAUAAAGU ....((....))..................(((((((((.----.....)))))))))... ( -14.10, z-score = -4.06, R) >droEre2.scaffold_4784 13706272 57 + 25762168 UAACGCGUAAGCAAAUAAUAAAUAAACCCCUUGUUGCGCA----AAAAAGUGCAAUAAAGU ....((....))..................(((((((((.----.....)))))))))... ( -14.10, z-score = -4.06, R) >droAna3.scaffold_13337 1562880 50 - 23293914 UAGCGCGUAAGCCAAUGAUAAAUAAAGUCCUGGUUGCGAA-----AAAAGUGCAA------ ..((((...(((((..(((.......))).))))).....-----....))))..------ ( -8.90, z-score = -0.68, R) >dp4.chrXR_group8 2489735 61 - 9212921 UAACGCGUAAGCAAAUAAUAAAUAAAGCUCUCGUUGCGCACCAGAAAAAGUGCAAUAAAGA ....((....))....................(((((((..........)))))))..... ( -11.20, z-score = -1.48, R) >droPer1.super_36 585220 61 + 818889 UAACGCGUAAGCAAAUAAUAAAUAAAGCUCUCGUUGCGCACCAGAAAAAGUGCAAUAAAGA ....((....))....................(((((((..........)))))))..... ( -11.20, z-score = -1.48, R) >droVir3.scaffold_13049 5543263 50 - 25233164 UACCGCUUGAACAAACAAUAAAUGAUAAAACAAAGAGGCUUU---AAUAAUAU-------- ..((.(((........................))).))....---........-------- ( -1.26, z-score = 0.23, R) >droMoj3.scaffold_6680 17367182 51 - 24764193 UAACGCUCGAGCAAAUAAUAAAUAAUGACACAAAAAGGCUUU---CA-AAUAAAU------ ....((....))..............................---..-.......------ ( -1.50, z-score = 0.61, R) >consensus UAACGCGUAAGCAAAUAAUAAAUAAACCCCUUGUUGCGCA____AAAAAGUGCAAUAAAGU ....((((((.......................))))))...................... ( -3.19 = -3.39 + 0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:24:07 2011