| Sequence ID | dm3.chr3L |
|---|---|
| Location | 13,361,459 – 13,361,551 |
| Length | 92 |
| Max. P | 0.911607 |
| Location | 13,361,459 – 13,361,551 |
|---|---|
| Length | 92 |
| Sequences | 3 |
| Columns | 93 |
| Reading direction | forward |
| Mean pairwise identity | 86.74 |
| Shannon entropy | 0.18490 |
| G+C content | 0.25900 |
| Mean single sequence MFE | -14.22 |
| Consensus MFE | -10.82 |
| Energy contribution | -11.93 |
| Covariance contribution | 1.11 |
| Combinations/Pair | 1.06 |
| Mean z-score | -2.41 |
| Structure conservation index | 0.76 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.22 |
| SVM RNA-class probability | 0.911607 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 13361459 92 + 24543557 UCGCUUAUAUUAUCUGCCUAUAUAU-UUUUCUUGCAUUGCGUUUUCUAUUAAUGCUUUUCUUCUUAUGUAAUCCGUUUAAUUAGGUAUUUAUU ..............((((((.....-.....((((((.(((((.......)))))..........))))))..........))))))...... ( -11.15, z-score = -1.60, R) >droSim1.chr3L 12758992 93 + 22553184 UCUCUUAAAUUAUCUGCUUUUAUCUUUUUUCUUGCAUUGCGUUAUAUAGCACUGCUUUUCUUCUUAUUUAAUCCUUUUAAGUAGGUAUUAAUU ..........(((((((................(((.(((........))).)))............((((.....)))))))))))...... ( -13.10, z-score = -2.35, R) >droSec1.super_0 5536437 93 + 21120651 UCUCUUAAAUUAUCUGCUUUUAUCUAUUUUCUUGCAUUGCGUUAUAUAGCAAUGCUUUUCUUCUCAUUUAAUGCUUUUAAGUAGGUAUUAAAU .................................(((((((........)))))))..........(((((((((((......))))))))))) ( -18.40, z-score = -3.29, R) >consensus UCUCUUAAAUUAUCUGCUUUUAUCU_UUUUCUUGCAUUGCGUUAUAUAGCAAUGCUUUUCUUCUUAUUUAAUCCUUUUAAGUAGGUAUUAAUU ..........((((((((...............(((((((........))))))).............(((.....)))))))))))...... (-10.82 = -11.93 + 1.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:23:25 2011