| Sequence ID | dm3.chr3L |
|---|---|
| Location | 13,226,600 – 13,226,652 |
| Length | 52 |
| Max. P | 0.991035 |
| Location | 13,226,600 – 13,226,652 |
|---|---|
| Length | 52 |
| Sequences | 6 |
| Columns | 65 |
| Reading direction | reverse |
| Mean pairwise identity | 75.00 |
| Shannon entropy | 0.41393 |
| G+C content | 0.29496 |
| Mean single sequence MFE | -10.03 |
| Consensus MFE | -8.64 |
| Energy contribution | -9.25 |
| Covariance contribution | 0.61 |
| Combinations/Pair | 1.09 |
| Mean z-score | -2.04 |
| Structure conservation index | 0.86 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.45 |
| SVM RNA-class probability | 0.991035 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 13226600 52 - 24543557 -------------GAAAUUUUUCGAAAACAUGUGAGUUUAGUUAAUGCGAAAUUAGCAAAACGAU -------------......................((((.((((((.....)))))).))))... ( -7.00, z-score = -0.39, R) >droAna3.scaffold_13337 11037559 65 + 23293914 GAAAAUAUCAAAAUAAAAACACUGAAAAUAGGCAAGUUUCUUAAAGGCGAAAUUAGCUAAACGAU ..............................(((.((((((........)))))).)))....... ( -6.90, z-score = -1.21, R) >droEre2.scaffold_4784 13236602 51 - 25762168 --------------GAAAUUUUCAGAAACAUGUGAGUUUAGUUAAUGCGAAAUUAGCUGAACGAU --------------.......(((.(....).)))(((((((((((.....)))))))))))... ( -11.70, z-score = -2.73, R) >droYak2.chr3L 13314703 51 - 24197627 --------------GAAAUUUUCAACAACAUGUGAGUUUAGUUAAUGCGAAAUUAGCUGAACGAU --------------.....................(((((((((((.....)))))))))))... ( -11.60, z-score = -2.61, R) >droSec1.super_0 5401815 52 - 21120651 -------------GAACUUUUUUGAAAACGUGUGAGUUUAGUUAAUGCGAAAUUAGCUAAACGAC -------------......................(((((((((((.....)))))))))))... ( -11.50, z-score = -2.25, R) >droSim1.chr3L 12622026 52 - 22553184 -------------GAAAUUUUUUUAAAACAUGUGAGUUUAGUUAAUGCGAAAUUAGCUAAACGAU -------------......................(((((((((((.....)))))))))))... ( -11.50, z-score = -3.05, R) >consensus _____________GAAAAUUUUCGAAAACAUGUGAGUUUAGUUAAUGCGAAAUUAGCUAAACGAU ...................................(((((((((((.....)))))))))))... ( -8.64 = -9.25 + 0.61)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:23:06 2011