Sequence ID | dm3.chr3L |
---|---|
Location | 12,993,857 – 12,993,921 |
Length | 64 |
Max. P | 0.988939 |
Location | 12,993,857 – 12,993,921 |
---|---|
Length | 64 |
Sequences | 6 |
Columns | 64 |
Reading direction | forward |
Mean pairwise identity | 92.50 |
Shannon entropy | 0.14170 |
G+C content | 0.37500 |
Mean single sequence MFE | -17.75 |
Consensus MFE | -16.84 |
Energy contribution | -16.65 |
Covariance contribution | -0.19 |
Combinations/Pair | 1.25 |
Mean z-score | -2.42 |
Structure conservation index | 0.95 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.34 |
SVM RNA-class probability | 0.988939 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 12993857 64 + 24543557 UGCGCAUUUUGGAUUGUGGCAUUCGGAAAAUUUAGCUGAAUGCUUCAGUAUUUUAAAGAUGUUG ...(((((((..((((.(((((((((.........))))))))).))))......))))))).. ( -18.30, z-score = -2.76, R) >droSim1.chr3L 12381634 64 + 22553184 UGCGCAUUUUGGAUUGUGGCAUUCGGAAAAUUUAGCUGAAUGCUUUAGUAUUUUAAAGAUGCUG ...(((((((..((((.(((((((((.........))))))))).))))......))))))).. ( -19.10, z-score = -2.99, R) >droSec1.super_0 5165651 64 + 21120651 UGCGCAUUUUGGAUUGUGGCAUUCGGAAAAUUUAGCUGAAUGCUUUAGUAUUUUAAAGAUGUUG ...(((((((..((((.(((((((((.........))))))))).))))......))))))).. ( -16.60, z-score = -2.41, R) >droYak2.chr3L 13071695 64 + 24197627 UGCGCAUUUUGGAUUGUGGCAUUCGGAAAAUUUAGCUGGAUGCUUUAGUAUUUUAAAGAUGCUG ...(((((((..((((.(((((((((.........))))))))).))))......))))))).. ( -18.60, z-score = -2.71, R) >droEre2.scaffold_4784 13000320 64 + 25762168 UGCGCAUUUUGGAUUGUGGCAUUCGGAAAAUUUAGCCGGAUGCUUUAGUACUUUAAAGAUGCUG ...(((((((((((((.(((((((((.........))))))))).)))).))...))))))).. ( -20.80, z-score = -3.19, R) >droAna3.scaffold_13337 6528152 64 - 23293914 UGCGUAUUUCGGAUUGUGGCAUUCCGAAAAUUUGGCUGGUUGCUUUAGUAUUUUAAGGAUUCGG ......(((((((.((...)).)))))))......((((...((((((....))))))..)))) ( -13.10, z-score = -0.47, R) >consensus UGCGCAUUUUGGAUUGUGGCAUUCGGAAAAUUUAGCUGAAUGCUUUAGUAUUUUAAAGAUGCUG ...(((((((..((((.(((((((((.........))))))))).))))......))))))).. (-16.84 = -16.65 + -0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:22:30 2011