| Sequence ID | dm3.chr3L |
|---|---|
| Location | 12,281,376 – 12,281,450 |
| Length | 74 |
| Max. P | 0.974975 |
| Location | 12,281,376 – 12,281,450 |
|---|---|
| Length | 74 |
| Sequences | 3 |
| Columns | 74 |
| Reading direction | forward |
| Mean pairwise identity | 97.30 |
| Shannon entropy | 0.03723 |
| G+C content | 0.50450 |
| Mean single sequence MFE | -12.90 |
| Consensus MFE | -12.90 |
| Energy contribution | -12.90 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.01 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.92 |
| SVM RNA-class probability | 0.974975 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 12281376 74 + 24543557 CACGAAUCUCCCAAAGCUGGCUAACCCGCAAAACCCCUUAACCCAAUGAUGCCAAACAACUGGCACAAGUGACU (((............((.((....)).)).................((.(((((......))))))).)))... ( -13.50, z-score = -2.21, R) >droSim1.chr3L 11659769 74 + 22553184 CACCAAUCCCCCAAAGCUGGCUAACCCGCAAAACCCCUUAACCCAAUGAUGCCAAACAACUGGCACAAGUGACU (((............((.((....)).)).................((.(((((......))))))).)))... ( -12.60, z-score = -1.97, R) >droSec1.super_0 4466132 74 + 21120651 CACCAAUCCCCCAAAGCUGGCUAACCCGCAAAACCCCUUAACCCAAUGAUGCCAAACAACUGGCACAAGUGAUU (((............((.((....)).)).................((.(((((......))))))).)))... ( -12.60, z-score = -1.84, R) >consensus CACCAAUCCCCCAAAGCUGGCUAACCCGCAAAACCCCUUAACCCAAUGAUGCCAAACAACUGGCACAAGUGACU (((............((.((....)).)).................((.(((((......))))))).)))... (-12.90 = -12.90 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:20:44 2011