| Sequence ID | dm3.chr3L |
|---|---|
| Location | 12,208,062 – 12,208,120 |
| Length | 58 |
| Max. P | 0.981631 |
| Location | 12,208,062 – 12,208,120 |
|---|---|
| Length | 58 |
| Sequences | 3 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 74.12 |
| Shannon entropy | 0.33671 |
| G+C content | 0.42953 |
| Mean single sequence MFE | -5.78 |
| Consensus MFE | -5.14 |
| Energy contribution | -5.47 |
| Covariance contribution | 0.33 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.94 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.08 |
| SVM RNA-class probability | 0.981631 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 12208062 58 + 24543557 AUGUGGCGCCCCCA--UCCCAAAAAGUAUGCUACAUAUUUCCCCCCGCCAAAAAAAAAAG ((((((((..(...--.........)..))))))))........................ ( -7.20, z-score = -2.18, R) >droSim1.chr3L 11582153 50 + 22553184 AUGUGGCGCCCUCA--UCCCAAAAAGUAUGCUACAA------UACUAACAAAAACAAG-- .(((((((..((..--........))..))))))).------................-- ( -8.00, z-score = -2.28, R) >droSec1.super_0 4393218 52 + 21120651 AUGUCGCGCCCCCCCUUCCCAAAAAGUAUGCUACAA------UACCAAAAAAAAAAAG-- .(((.(((..(..............)..))).))).------................-- ( -2.14, z-score = -1.36, R) >consensus AUGUGGCGCCCCCA__UCCCAAAAAGUAUGCUACAA______UACCAACAAAAAAAAG__ .(((((((..(..............)..)))))))......................... ( -5.14 = -5.47 + 0.33)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:20:30 2011