| Sequence ID | dm3.chr3L |
|---|---|
| Location | 12,047,177 – 12,047,239 |
| Length | 62 |
| Max. P | 0.633009 |
| Location | 12,047,177 – 12,047,239 |
|---|---|
| Length | 62 |
| Sequences | 5 |
| Columns | 71 |
| Reading direction | forward |
| Mean pairwise identity | 70.92 |
| Shannon entropy | 0.46936 |
| G+C content | 0.47012 |
| Mean single sequence MFE | -18.98 |
| Consensus MFE | -8.09 |
| Energy contribution | -8.13 |
| Covariance contribution | 0.04 |
| Combinations/Pair | 1.08 |
| Mean z-score | -1.88 |
| Structure conservation index | 0.43 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.30 |
| SVM RNA-class probability | 0.633009 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 12047177 62 + 24543557 GCAUGCGCAGUGAAAAGAGCGCAGAAAAC---------GCGAAGAUGCUUUUUGGGAUUGCGCAAGCGCAA ((.((((((((..(((((((((.......---------.....).))))))))...)))))))).)).... ( -20.90, z-score = -1.00, R) >droAna3.scaffold_13337 11422717 64 - 23293914 GCAUGCGCAAUGAAAAGAGCCCAGAAACGUA-------GCAAAGAAGCUUUUUGGAAUUGCGCAAGCGCAA ((.((((((((..(((((((...........-------........)))))))...)))))))).)).... ( -20.91, z-score = -2.35, R) >droEre2.scaffold_4784 12036430 50 + 25762168 ------------AAAAGAGCGCAGAAAAG---------GCGAAGAAGCUUUUUGGCAUUGCGCAGGCGCAA ------------......((((..(((((---------((......))))))).((.....))..)))).. ( -15.40, z-score = -0.91, R) >droYak2.chr3L 12094206 50 + 24197627 ------------AAAAGAACGCAGAAAAG---------GCGAAGAAGCUUUUUGCGAUUGCGCCAGCGCAA ------------.......(((((((..(---------((......)))))))))).(((((....))))) ( -16.20, z-score = -1.65, R) >droGri2.scaffold_15110 18326331 70 + 24565398 GCAUGCGCAACGAAAGGAGCGCAAAUAAAUACAUAUAAAAAAAGAAGCUUUUUGU-AUUGCGCAAGCGCAA ((.(((((..(....)..))))).........(((((((((.......)))))))-)).((....)))).. ( -21.50, z-score = -3.48, R) >consensus GCAUGCGCA__GAAAAGAGCGCAGAAAAG_________GCGAAGAAGCUUUUUGGGAUUGCGCAAGCGCAA .............(((((((..........................)))))))....(((((....))))) ( -8.09 = -8.13 + 0.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:20:14 2011