| Sequence ID | dm3.chr3L |
|---|---|
| Location | 11,359,732 – 11,359,832 |
| Length | 100 |
| Max. P | 0.709708 |
| Location | 11,359,732 – 11,359,832 |
|---|---|
| Length | 100 |
| Sequences | 3 |
| Columns | 107 |
| Reading direction | forward |
| Mean pairwise identity | 89.81 |
| Shannon entropy | 0.14119 |
| G+C content | 0.65810 |
| Mean single sequence MFE | -20.11 |
| Consensus MFE | -16.94 |
| Energy contribution | -17.28 |
| Covariance contribution | 0.33 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.77 |
| Structure conservation index | 0.84 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.47 |
| SVM RNA-class probability | 0.709708 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 11359732 100 + 24543557 AUUUACUCAGUGCCCCAGACCCCGAUGCCGAGCAGCGACCCACAGUGC-------UGCCCCCGACCACCCACCGCACACCUUGCCACACCACUUGGGCACCACCACC .........((((((.((..........((.((((((........)))-------)))...))..........(((.....))).......)).))))))....... ( -22.70, z-score = -2.35, R) >droSec1.super_0 3569041 99 + 21120651 AUUUACUCAGUGCCCCAGACCCCGAUGCCGAGCAGCGACCCACAGUGC-------AGCCCCC-ACCACCCACCGCACACCUUGCCACACCACUUGGGCACCACCGCC .........((((((.((....((.(((...))).)).......((((-------.......-..........))))..............)).))))))....... ( -19.83, z-score = -1.19, R) >droYak2.chr3L 11394698 105 + 24197627 AUUUACUCAGUGCCCCAGACCCCGAUGCCGAGCAGCGACCCACAGUGCGAAGCACCACCCCCCACCACCCACCGCACACCUUGCCACUCCACUUAGGCACC--CACC .........(((((..((....((.(((...))).)).......(((((.......................)))))..............))..))))).--.... ( -17.80, z-score = -1.75, R) >consensus AUUUACUCAGUGCCCCAGACCCCGAUGCCGAGCAGCGACCCACAGUGC_______AGCCCCC_ACCACCCACCGCACACCUUGCCACACCACUUGGGCACCACCACC .........((((((.((....((.(((...))).)).......((((.........................))))..............)).))))))....... (-16.94 = -17.28 + 0.33)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:18:26 2011