| Sequence ID | dm3.chr3L |
|---|---|
| Location | 10,697,317 – 10,697,409 |
| Length | 92 |
| Max. P | 0.807263 |
| Location | 10,697,317 – 10,697,409 |
|---|---|
| Length | 92 |
| Sequences | 5 |
| Columns | 110 |
| Reading direction | reverse |
| Mean pairwise identity | 73.71 |
| Shannon entropy | 0.42753 |
| G+C content | 0.31632 |
| Mean single sequence MFE | -24.38 |
| Consensus MFE | -8.96 |
| Energy contribution | -10.92 |
| Covariance contribution | 1.96 |
| Combinations/Pair | 1.23 |
| Mean z-score | -2.61 |
| Structure conservation index | 0.37 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.75 |
| SVM RNA-class probability | 0.807263 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 10697317 92 - 24543557 ---CUUUUGUAUGUAUGGUG----UGUGGCAUUUUAUUUAUGCGAUGCCUG-UGCAAAAGAUUCAGGAAUAAAUGUUGAAUUUUUAAUGCAA-AUAUAAAG--------- ---..(((((((((((((.(----(((.((((.......)))).)))))))-))).((((((((((.(.....).)))))))))).))))))-).......--------- ( -25.10, z-score = -3.38, R) >droSec1.super_0 2918092 91 - 21120651 ---CUUUUGUAUAUAUGGUG----UAUGGCAUUUUAUUUAUGCGAUGCCUG-UGCAAAAGAUUCAGGAA-AAAUGUUGAAUUUUUAAUGCAA-AUAUAAAG--------- ---..(((((((..((((.(----(((.((((.......)))).)))))))-)(((((((((((((.(.-...).))))))))))..)))..-))))))).--------- ( -22.50, z-score = -2.63, R) >droYak2.chr3L 10707609 91 - 24197627 ---CUUUUGUAUAUAUGGUG----UGCGGCAUUUUAUUUAUGCGAUGCCUG-UGCAAAAGAUUCAGGAA-AAAUGUUGAAUUUUUAAUGCAA-AUAUAAAG--------- ---..(((((((......((----..(((((((.((....)).)))))).)-..))((((((((((.(.-...).)))))))))).))))))-).......--------- ( -22.40, z-score = -2.20, R) >droEre2.scaffold_4784 10696192 91 - 25762168 ---CUUUUGUAUAUAUGGUG----UGUGGCAUUUUAUUUAUGCGAUGCCUG-UGCAAAAGAUUCACGAG-AAAUGUUGAAUUUUUAAUGCAA-AUAUAAAG--------- ---..(((((((..((((.(----(((.((((.......)))).)))))))-)((((((((((((..(.-...)..)))))))))..)))..-))))))).--------- ( -20.90, z-score = -1.82, R) >droMoj3.scaffold_6680 14014366 109 + 24764193 AUGUUGUGGAAAAUGCGGUGAAAAUGUUGCAUUGUG-AUAUGCCAUAAAAACUGUAAGUGGAGCAUAAGCGAAUGCUUAAUGCUCUACGUAGUAGAUACCCUAUACAAGU .(((...((....((((((....(((..((((....-..)))))))....)))))).(((((((((((((....)))).)))))))))...........))...)))... ( -31.00, z-score = -3.04, R) >consensus ___CUUUUGUAUAUAUGGUG____UGUGGCAUUUUAUUUAUGCGAUGCCUG_UGCAAAAGAUUCAGGAA_AAAUGUUGAAUUUUUAAUGCAA_AUAUAAAG_________ .....(((((((...............((((((.((....)).))))))...((((((((((((((.(.....).))))))))))..))))..))))))).......... ( -8.96 = -10.92 + 1.96)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:16:48 2011