| Sequence ID | dm3.chr3L |
|---|---|
| Location | 10,695,994 – 10,696,074 |
| Length | 80 |
| Max. P | 0.987572 |
| Location | 10,695,994 – 10,696,074 |
|---|---|
| Length | 80 |
| Sequences | 6 |
| Columns | 80 |
| Reading direction | reverse |
| Mean pairwise identity | 72.75 |
| Shannon entropy | 0.53084 |
| G+C content | 0.40179 |
| Mean single sequence MFE | -21.54 |
| Consensus MFE | -12.31 |
| Energy contribution | -12.76 |
| Covariance contribution | 0.45 |
| Combinations/Pair | 1.50 |
| Mean z-score | -2.01 |
| Structure conservation index | 0.57 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.28 |
| SVM RNA-class probability | 0.987572 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 10695994 80 - 24543557 UAUUUGGGGGCAGUACUUAAUGCAUAUAUCCUUUCAAAGGGUUGCAUAAGCCUUUUGAAGUGCUUCAUACGCUUUCAGAG ..((((..(((.(((......((((.......(((((((((((.....)))))))))))))))....))))))..)))). ( -25.61, z-score = -3.31, R) >droSim1.chr3L 10088180 80 - 22553184 UGUUUGGGGGCAGUACUUAAUGCAUAUAUCCUUUCAAAGGGUUUCAUAAGCCUUUUGAAGUGCUUUAUACGCUUUCAGAG ..((((..(((.(((..(((.((((.......(((((((((((.....))))))))))))))).)))))))))..)))). ( -25.21, z-score = -3.45, R) >droSec1.super_0 2916818 80 - 21120651 UGUUUGGGGGCAGUACUUAAUGCAUAUGUCCUUUCAAAGGGUUUCAUAAGCCUUUUGAAGUGCUUCAUACGCUUUCAGAG ..((((..(((.(((......((((.......(((((((((((.....)))))))))))))))....))))))..)))). ( -24.41, z-score = -2.74, R) >droYak2.chr3L 10706265 80 - 24197627 UGUUUGCGGGCAGUACUUAAUGCACAUAUCCUUUCAAAGGGUUGCAUAAGCCUUUCCAAGUGUUUCAUACGCCUGCGGAG ..(((((((((....((((.((((...(((((.....))))))))))))).........((((...))))))))))))). ( -23.90, z-score = -1.86, R) >droEre2.scaffold_4784 10694892 80 - 25762168 UGUUUGCGGGCAGUACUUAAUGCACAUAUCCUUUCAAAGGGUUGCAUAAGCCUUUUCGAGUGCUACAUACGCGUUCGCAG ....(((((((.(((......((((........((((((((((.....)))))))).))))))....)))..))))))). ( -22.20, z-score = -1.46, R) >droAna3.scaffold_13337 15607771 70 - 23293914 CCCUUAGAAUGGGUAUGGAAUAUUGAUA-------GAAGAACUAUUU---CAUUUAAAAAAAAUAUAUGAUUGUCAAGGG (((((.((....(((((.....((((..-------((((.....)))---)..))))......))))).....))))))) ( -7.90, z-score = 0.79, R) >consensus UGUUUGGGGGCAGUACUUAAUGCAUAUAUCCUUUCAAAGGGUUGCAUAAGCCUUUUGAAGUGCUUCAUACGCUUUCAGAG ..(((((((((.(((......((((.......((.((((((((.....)))))))).))))))....)))))))))))). (-12.31 = -12.76 + 0.45)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:16:47 2011