| Sequence ID | dm3.chr3L |
|---|---|
| Location | 10,357,865 – 10,357,924 |
| Length | 59 |
| Max. P | 0.839768 |
| Location | 10,357,865 – 10,357,924 |
|---|---|
| Length | 59 |
| Sequences | 5 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 92.37 |
| Shannon entropy | 0.13891 |
| G+C content | 0.30847 |
| Mean single sequence MFE | -8.08 |
| Consensus MFE | -7.34 |
| Energy contribution | -7.34 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.62 |
| Structure conservation index | 0.91 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.87 |
| SVM RNA-class probability | 0.839768 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 10357865 59 + 24543557 AAUAAUAGUAAAACGCGCACAAACGCGUCCAUUUCCAGAUUAUUAAUAAUGAUUUGAAA ............(((((......))))).......((((((((.....))))))))... ( -10.60, z-score = -2.51, R) >droEre2.scaffold_4784 10352670 59 + 25762168 AAUAAUAGUUAAACCCGCACACACGCGUAUAUUUCCAGAUUAUUAAUAAUGAUUUGAAA ...............(((......)))........((((((((.....))))))))... ( -7.40, z-score = -1.69, R) >droYak2.chr3L 10348441 59 + 24197627 AAUAAUGGUUUAACCCGCACACACGCGCCGAUUUCCAGAUUAUUAAUAAUGAUUUGAAA ......((.....))(((......)))........((((((((.....))))))))... ( -7.60, z-score = -0.65, R) >droSec1.super_0 2570716 59 + 21120651 AAUAAUAGUAAAAACCGCACACACGCGUUCAUUUCCAGAUUAUUAAUAAUGAUUUGAAA ...............(((......)))........((((((((.....))))))))... ( -7.40, z-score = -1.48, R) >droSim1.chr3L 9747533 59 + 22553184 AAUAAUAGUAAAACCCGCACACACGCGUUCAUUUCCAGAUUAUUAAUAAUGAUUUGAAA ...............(((......)))........((((((((.....))))))))... ( -7.40, z-score = -1.78, R) >consensus AAUAAUAGUAAAACCCGCACACACGCGUCCAUUUCCAGAUUAUUAAUAAUGAUUUGAAA ...............(((......)))........((((((((.....))))))))... ( -7.34 = -7.34 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:15:58 2011