| Sequence ID | dm3.chr3L |
|---|---|
| Location | 10,102,588 – 10,102,638 |
| Length | 50 |
| Max. P | 0.641144 |
| Location | 10,102,588 – 10,102,638 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 50 |
| Reading direction | reverse |
| Mean pairwise identity | 86.67 |
| Shannon entropy | 0.18366 |
| G+C content | 0.32000 |
| Mean single sequence MFE | -6.23 |
| Consensus MFE | -6.57 |
| Energy contribution | -6.13 |
| Covariance contribution | -0.44 |
| Combinations/Pair | 1.18 |
| Mean z-score | -0.33 |
| Structure conservation index | 1.05 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.32 |
| SVM RNA-class probability | 0.641144 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 10102588 50 - 24543557 UAAGUUAUUACUGAAAUGGUGCUUUUCGAUGGCGUACAAAAGCAUUCGAA ........((((.....))))...(((((..((........))..))))) ( -6.60, z-score = 0.33, R) >droSim1.chr3L 9483502 50 - 22553184 AUUAUUAUUACUAAAACGGUAUUUUUCGAUGGCAUACAAAAGCAUUCGAA ........((((.....))))...(((((..((........))..))))) ( -5.90, z-score = -1.05, R) >droSec1.super_0 2318570 50 - 21120651 UAAGUUAUUGCUAAAACGGUAUUUUUCGAUGGCAUACAAAAGCAUUCGAA ...((...(((((...(((......))).))))).))............. ( -6.20, z-score = -0.29, R) >consensus UAAGUUAUUACUAAAACGGUAUUUUUCGAUGGCAUACAAAAGCAUUCGAA ........((((.....))))...(((((..((........))..))))) ( -6.57 = -6.13 + -0.44)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:15:04 2011