| Sequence ID | dm3.chr3L |
|---|---|
| Location | 9,998,983 – 9,999,071 |
| Length | 88 |
| Max. P | 0.968112 |
| Location | 9,998,983 – 9,999,071 |
|---|---|
| Length | 88 |
| Sequences | 3 |
| Columns | 88 |
| Reading direction | reverse |
| Mean pairwise identity | 80.23 |
| Shannon entropy | 0.28075 |
| G+C content | 0.31246 |
| Mean single sequence MFE | -17.34 |
| Consensus MFE | -14.14 |
| Energy contribution | -14.70 |
| Covariance contribution | 0.56 |
| Combinations/Pair | 1.09 |
| Mean z-score | -2.15 |
| Structure conservation index | 0.82 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.79 |
| SVM RNA-class probability | 0.968112 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 9998983 88 - 24543557 UUCCCUUUUGUUAUUUUCCUUUUUUUGGUUGUUUGUGUGUGUUUUGAGUAGAAAGCGCACCAAAGCGAGUGGAAAUAAUUCAUUUGUG .................((.......))...((((.(((((((((......)))))))))))))(((((((((.....))))))))). ( -19.70, z-score = -2.38, R) >droYak2.chr3L 9975484 80 - 24197627 -------UUCCCAUUUUUUUUGUUUU-AUUUUUUUUGUGUGUUUUGAGUAGAAAGCGCACCAAAGCGAGUGAAAAUAAUUUAUUUGUG -------...............((((-((((.(((((((((((((......)))))))).))))).)))))))).............. ( -15.30, z-score = -2.34, R) >droEre2.scaffold_4784 9984315 84 - 25762168 UUCUACUUUGUUGUUUUUUUUUUU----UUUUUUGUGUGUUUUUGGAGUAGAAAGCGCACCAAAGCGAGUGGAAAUAAUUUAUUUGUG ((((((((..(((...........----......((((((((((......)))))))))))))...)))))))).............. ( -17.02, z-score = -1.73, R) >consensus UUC___UUUGUUAUUUUUUUUUUUUU__UUUUUUGUGUGUGUUUUGAGUAGAAAGCGCACCAAAGCGAGUGGAAAUAAUUUAUUUGUG ...............................((((.(((((((((......)))))))))))))(((((((((.....))))))))). (-14.14 = -14.70 + 0.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:14:49 2011