| Sequence ID | dm3.chr3L |
|---|---|
| Location | 9,228,284 – 9,228,345 |
| Length | 61 |
| Max. P | 0.567054 |
| Location | 9,228,284 – 9,228,345 |
|---|---|
| Length | 61 |
| Sequences | 5 |
| Columns | 62 |
| Reading direction | reverse |
| Mean pairwise identity | 91.86 |
| Shannon entropy | 0.14374 |
| G+C content | 0.34747 |
| Mean single sequence MFE | -12.28 |
| Consensus MFE | -8.74 |
| Energy contribution | -8.82 |
| Covariance contribution | 0.08 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.21 |
| Structure conservation index | 0.71 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.15 |
| SVM RNA-class probability | 0.567054 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 9228284 61 - 24543557 GCAAUGAAAUUGCUUUGGUCAACCACCGCAUUAAUCUCU-UAAUGCUUAAUGCUUUUCAAUA ....(((((..((..(((....)))..(((((((....)-)))))).....)).)))))... ( -12.70, z-score = -2.66, R) >droSim1.chr3L 8625080 60 - 22553184 GCAACGAAAUUGCUUUGGUUAACCACCGCAUUAAUCUCU-UAAUGCUUAAUGC-UUUCAAUA .....((((..((..(((....)))..(((((((....)-)))))).....))-)))).... ( -10.70, z-score = -2.03, R) >droSec1.super_0 1485179 62 - 21120651 GCAAUGAAAUUGCUUUGGUUAACCACCGCAUUAAUCUCUGCGGUGCUUAAUGUUUUUCAAUA (((((...)))))....(((((.(((((((........))))))).)))))........... ( -16.70, z-score = -3.12, R) >droYak2.chr3L 21506849 61 + 24197627 GCAAUGAAAUUGCCUUGGUUAACCAGCUCAUUAAUCUCU-UAAUGCUUAAUGCUUUUCAAUA ....(((((..((.((((....))))..((((((....)-)))))......)).)))))... ( -8.40, z-score = -0.46, R) >droEre2.scaffold_4784 20947139 61 + 25762168 GCAAUGAAAUUGCUUUGGUCAACCACCGCAUUAAACUCU-UAAUGCUUAAUGCUUUUCAAUA ....(((((..((..(((....)))..(((((((....)-)))))).....)).)))))... ( -12.90, z-score = -2.78, R) >consensus GCAAUGAAAUUGCUUUGGUUAACCACCGCAUUAAUCUCU_UAAUGCUUAAUGCUUUUCAAUA ((((.....))))..(((....)))..(((((((.(........).)))))))......... ( -8.74 = -8.82 + 0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:13:20 2011