| Sequence ID | dm3.chr2L |
|---|---|
| Location | 4,644,618 – 4,644,679 |
| Length | 61 |
| Max. P | 0.638950 |
| Location | 4,644,618 – 4,644,679 |
|---|---|
| Length | 61 |
| Sequences | 6 |
| Columns | 70 |
| Reading direction | forward |
| Mean pairwise identity | 67.60 |
| Shannon entropy | 0.58174 |
| G+C content | 0.49816 |
| Mean single sequence MFE | -13.96 |
| Consensus MFE | -6.71 |
| Energy contribution | -6.77 |
| Covariance contribution | 0.06 |
| Combinations/Pair | 1.40 |
| Mean z-score | -1.10 |
| Structure conservation index | 0.48 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.31 |
| SVM RNA-class probability | 0.638950 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 4644618 61 + 23011544 CCACCAAAUCAAGGUGGACAUCCACCAGGAUCACAGAAGCCUCCUAAUGUGGGAAUAUACC--------- ((((........(((((....)))))((((...........))))...)))).........--------- ( -16.40, z-score = -1.46, R) >droSim1.chr2L 4518487 61 + 22036055 CCACCAAUUCAAGGUGGACAACCACCAGGAUCACAGAAGCCUCCUAAUUCAGGAAUAUACC--------- ...((.......(((((....)))))((((...........))))......))........--------- ( -12.50, z-score = -1.44, R) >droSec1.super_5 2729344 61 + 5866729 CCACCAAUUCAAGGUGGACAUCCACCAGGAUCACAGAACCCUCCUAAUUCCGGUAUAUACC--------- ..(((.......(((((....))))).(((.....((....)).....)))))).......--------- ( -15.10, z-score = -2.17, R) >droYak2.chr2L 4658571 61 + 22324452 CCACCAAAUCUAGGUGGACAUCCACCAGGAACACAGCUGCCUCCUAACUUAGGAACAAACC--------- ........(((.(((((....))))).)))...........(((((...))))).......--------- ( -14.70, z-score = -1.95, R) >droEre2.scaffold_4929 4724882 61 + 26641161 CCAUCAAAUCAAUGUGGACAUCCACCAGAAUCACAGAUGCCUCCUAAUUCAAAUGUAUCCU--------- .............((((....))))..........(((((..............)))))..--------- ( -6.84, z-score = -0.12, R) >droWil1.scaffold_180698 4445666 67 - 11422946 CCACCGAUUCCGGGU---UGUCCACCGGCUCCAGGCUGAGUUCCAUAACCGGGUUGGCCUCCAAUCAGUC ...((((..((.(((---(((..((((((.....)))).))...)))))).))))))............. ( -18.20, z-score = 0.51, R) >consensus CCACCAAAUCAAGGUGGACAUCCACCAGGAUCACAGAAGCCUCCUAAUUCAGGAAUAUACC_________ ...((.......(((((....)))))(((..........))).........))................. ( -6.71 = -6.77 + 0.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:17:07 2011