| Sequence ID | dm3.chr3L |
|---|---|
| Location | 8,894,163 – 8,894,218 |
| Length | 55 |
| Max. P | 0.995368 |
| Location | 8,894,163 – 8,894,218 |
|---|---|
| Length | 55 |
| Sequences | 5 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 67.30 |
| Shannon entropy | 0.57398 |
| G+C content | 0.33254 |
| Mean single sequence MFE | -12.34 |
| Consensus MFE | -7.40 |
| Energy contribution | -8.36 |
| Covariance contribution | 0.96 |
| Combinations/Pair | 1.36 |
| Mean z-score | -2.00 |
| Structure conservation index | 0.60 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.80 |
| SVM RNA-class probability | 0.995368 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 8894163 55 + 24543557 UUGUGU-UAUAAAGGUGCUUUGCUAGUUCAAGGCGAAGUUCUUUUAGUUUCAUUUA---- ..(((.-..((((((.((((((((.......)))))))).))))))....)))...---- ( -14.70, z-score = -3.38, R) >droSim1.chr3L 8329829 56 + 22553184 UUGUAUAUAUAAAGGUGCUUUGCUAGUUCAAGGCGAAGUUCUUUUAGUUUCAUUUA---- .........((((((.((((((((.......)))))))).))))))..........---- ( -13.60, z-score = -2.96, R) >droSec1.super_0 1164757 56 + 21120651 UUGUAUAUAUAAAGGUGCUUUGCUAGUUCAAGGCGAAGUUUUUUUAGUUUCAUUUA---- .........((((((.((((((((.......)))))))).))))))..........---- ( -11.40, z-score = -1.99, R) >droEre2.scaffold_4784 20612820 52 - 25762168 UUGUAU-UAUAAAGGUGCUCUGCUAUUUCAAGGCGAAGGUCU---ACUUUCAUUUA---- ..((((-(.....)))))...(((.......)))(((((...---.))))).....---- ( -7.60, z-score = -0.17, R) >droMoj3.scaffold_6680 4901309 60 + 24764193 ACGCAGUGUCAAUAGAGAGUUCUUAAUCAGAAAUGAAAUCCUGCUCUUGCUGUUGCUCUA ....((.(.(((((((((((......(((....)))......)))))..))))))).)). ( -14.40, z-score = -1.47, R) >consensus UUGUAU_UAUAAAGGUGCUUUGCUAGUUCAAGGCGAAGUUCUUUUAGUUUCAUUUA____ .........((((((.((((((((.......)))))))).)))))).............. ( -7.40 = -8.36 + 0.96)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:12:35 2011