| Sequence ID | dm3.chr3L |
|---|---|
| Location | 8,039,121 – 8,039,180 |
| Length | 59 |
| Max. P | 0.894753 |
| Location | 8,039,121 – 8,039,180 |
|---|---|
| Length | 59 |
| Sequences | 5 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 72.92 |
| Shannon entropy | 0.46540 |
| G+C content | 0.31892 |
| Mean single sequence MFE | -7.92 |
| Consensus MFE | -6.03 |
| Energy contribution | -6.27 |
| Covariance contribution | 0.24 |
| Combinations/Pair | 1.30 |
| Mean z-score | -1.14 |
| Structure conservation index | 0.76 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.12 |
| SVM RNA-class probability | 0.894753 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 8039121 59 + 24543557 UGUGGUUUUCAGGGAACCAUAAU---UUCUUUAUUUAAUUUUUGUGGUUUUACGUCUUUCCC ...((.......((((((((((.---...............))))))))))........)). ( -9.45, z-score = -0.84, R) >droYak2.chr3L 8625522 62 + 24197627 UUUAGUUUUCUAGGAACCAUAAUAAUUUCUUAAUUUAUUUCUUGUGGUUUCACAUCUCCCCC ............((((((((((.((.............)).))))))))))........... ( -10.02, z-score = -2.36, R) >droSec1.super_0 326217 59 + 21120651 UGUGGUUUUCAAGAAACCAUAAU---UUCUUUAUUUAAUAUUUGUGGUUUUACGUCUUCCCC ...((.......((((((((((.---...............)))))))))).......)).. ( -9.33, z-score = -1.63, R) >droSim1.chr3L 7503104 59 + 22553184 UGUGGUUUUCAAGAAACCAUAAU---UUCUUUAUUUAAUUCUUGUGGUUUUACGUCUUUCCC ...((.......((((((((((.---...............))))))))))........)). ( -7.95, z-score = -1.18, R) >droPer1.super_1 1944059 59 + 10282868 CUCUCUGUUUAAAAAACGAUGUA---UCCCAUAUUCCAUAUUGCUAGUUUUUCAUCUUCCGG ...........((((((...(((---...............)))..)))))).......... ( -2.86, z-score = 0.29, R) >consensus UGUGGUUUUCAAGAAACCAUAAU___UUCUUUAUUUAAUUUUUGUGGUUUUACGUCUUCCCC ............((((((((((...................))))))))))........... ( -6.03 = -6.27 + 0.24)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:10:44 2011