| Sequence ID | dm3.chr3L |
|---|---|
| Location | 7,601,597 – 7,601,677 |
| Length | 80 |
| Max. P | 0.882092 |
| Location | 7,601,597 – 7,601,677 |
|---|---|
| Length | 80 |
| Sequences | 5 |
| Columns | 80 |
| Reading direction | forward |
| Mean pairwise identity | 62.89 |
| Shannon entropy | 0.67065 |
| G+C content | 0.38714 |
| Mean single sequence MFE | -13.94 |
| Consensus MFE | -6.23 |
| Energy contribution | -6.28 |
| Covariance contribution | 0.05 |
| Combinations/Pair | 1.47 |
| Mean z-score | -1.22 |
| Structure conservation index | 0.45 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.05 |
| SVM RNA-class probability | 0.882092 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 7601597 80 + 24543557 AAAAAAAAACGUGCUAUCCGGCUUUACAAAAGUAUCGCAUAGAUAAGCAUAUUCUGCGCAUCUCCAGACUUUUGUAUCUG ............(((....)))..(((((((((.......((((..(((.....)))..))))....))))))))).... ( -14.70, z-score = -1.45, R) >droEre2.scaffold_4784 22026084 65 - 25762168 UUAAAAAAUUCUGGAGUCCGGUGUCGCAAAAGUAUCA---------------UCUGCACAUCUCCAGACUUUUGUAUCUG ....((((.(((((((....((((.(((.........---------------..)))))))))))))).))))....... ( -15.20, z-score = -2.93, R) >droSec1.super_2 7531013 80 + 7591821 UUACAAAAUCAUGCUACCCGGCUUUACAAAAGUAUCGCAUAGAUAAGCAUAUUCUGCGCAUCUCCAGGCUUUUGUAUCUG ............(((....)))..(((((((((.......((((..(((.....)))..))))....))))))))).... ( -15.00, z-score = -1.12, R) >droSim1.chr3L 7115936 80 + 22553184 UUAAAAAAUCAUGCUACCCGGCUUUACAAAAGUAUCGCAUAGAUAAGCAUAUUCUGCACAUCUCCAGGCUUUUGUAUCUG ............(((....)))..(((((((((.......((((..(((.....)))..))))....))))))))).... ( -14.00, z-score = -1.35, R) >droGri2.scaffold_15110 11133511 70 - 24565398 --CAAGAAAAGCGCAA-CAAACAAAAAACAGAUAAAA-----AGAAUUGCAACUUGUGAAUGCGCAG--CUGUGCAGUUG --..............-....................-----..(((((((..(((((....)))))--...))))))). ( -10.80, z-score = 0.73, R) >consensus UUAAAAAAUCAUGCUACCCGGCUUUACAAAAGUAUCGCAUAGAUAAGCAUAUUCUGCGCAUCUCCAGACUUUUGUAUCUG ..................(((...(((((((((...((........)).....(((........)))))))))))).))) ( -6.23 = -6.28 + 0.05)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:09:55 2011