| Sequence ID | dm3.chr3L |
|---|---|
| Location | 7,154,930 – 7,155,021 |
| Length | 91 |
| Max. P | 0.500000 |
| Location | 7,154,930 – 7,155,021 |
|---|---|
| Length | 91 |
| Sequences | 4 |
| Columns | 94 |
| Reading direction | reverse |
| Mean pairwise identity | 90.34 |
| Shannon entropy | 0.15676 |
| G+C content | 0.52344 |
| Mean single sequence MFE | -16.35 |
| Consensus MFE | -12.34 |
| Energy contribution | -12.65 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.06 |
| Mean z-score | -1.90 |
| Structure conservation index | 0.75 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.00 |
| SVM RNA-class probability | 0.500000 |
| Prediction | OTHER |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 7154930 91 - 24543557 UUGAAUGCUGUGGUUGCAAUC-AGAAAACCAACUCUGGACCCUUUCUUGUACUUGCACCCCC--AUCACCCCCCAACGAUUGCCACCCACCACC .....((.((.(((.((((((-(((((.(((....)))....)))))(((....))).....--.............)))))).))))).)).. ( -16.80, z-score = -1.87, R) >droYak2.chr3L 7751976 94 - 24197627 UUGAAUGCUGUGGUUGCAAUCAAAAAAACCAACUCUGGACCCUUUCUUGUACUUGCACCCCCUUAACACCCCCCAACGAUUGCCACCCACCAAC .....((.((.(((.((((((.......(((....))).........(((....)))....................)))))).))))).)).. ( -16.50, z-score = -2.29, R) >droEre2.scaffold_4784 21569452 91 + 25762168 UUGAAUGCUGUGGUUGCAAUC-AGAAAACCAACUCUGGACCCUUUCUUGUACUUGCACCCCC--AUCACCCCCCAACGAUUGCCACCCACCACC .....((.((.(((.((((((-(((((.(((....)))....)))))(((....))).....--.............)))))).))))).)).. ( -16.80, z-score = -1.87, R) >droAna3.scaffold_13337 1683766 91 - 23293914 UUGA--GCCGUGGUUGCACCUAAAAAAUCCAACUCUGGACCCUCUCUUGUACUUGCACCCCC-AACCACCCCGCAACGAUUGCAACCCACCACC ....--((.((.(((((..........((((....))))........(((....))).....-.........))))).)).))........... ( -15.30, z-score = -1.58, R) >consensus UUGAAUGCUGUGGUUGCAAUC_AAAAAACCAACUCUGGACCCUUUCUUGUACUUGCACCCCC__AUCACCCCCCAACGAUUGCCACCCACCACC .........((((..((((((.......(((....))).........(((....)))....................))))))...)))).... (-12.34 = -12.65 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:09:02 2011