| Sequence ID | dm3.chr3L |
|---|---|
| Location | 5,468,182 – 5,468,239 |
| Length | 57 |
| Max. P | 0.848554 |
| Location | 5,468,182 – 5,468,239 |
|---|---|
| Length | 57 |
| Sequences | 6 |
| Columns | 57 |
| Reading direction | forward |
| Mean pairwise identity | 61.64 |
| Shannon entropy | 0.75560 |
| G+C content | 0.35403 |
| Mean single sequence MFE | -9.62 |
| Consensus MFE | -4.26 |
| Energy contribution | -4.32 |
| Covariance contribution | 0.06 |
| Combinations/Pair | 1.50 |
| Mean z-score | -0.89 |
| Structure conservation index | 0.44 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.90 |
| SVM RNA-class probability | 0.848554 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 5468182 57 + 24543557 UAUUAUCAAUAUAUUUGCUUCUACUUUUUUUCUGCGUGUAUGAACGUGCAGCAAAUC ...........................(((.((((((((....)))))))).))).. ( -7.20, z-score = -0.36, R) >droEre2.scaffold_4784 8153421 56 + 25762168 UAUU-UGUUUAUAAUUGGUUGUACAAGUUCUCUGUGUGUAUGAGCGUGCAGAAAUCC .(((-(((.((........)).))))))..((((..(((....)))..))))..... ( -11.10, z-score = -1.58, R) >droYak2.chr3L 6028861 54 + 24197627 UAAUUUUAGUACAAUUGUUUCUAG---UUUUCUGCGUGUAUGAACGUGCAGAAAAUC ......(((.((....))..)))(---((((((((((((....))))))))))))). ( -12.90, z-score = -2.74, R) >droSec1.super_2 5404475 57 + 7591821 UAUUAUAAGUAUAAUUGCUUACACAUUUUUUUUGCGUGUAUGAACGUGCAACAAAUC .....((((((....))))))......(((.((((((((....)))))))).))).. ( -9.00, z-score = -0.48, R) >droSim1.chr3L 4981695 57 + 22553184 UAUUAUUAGUAUAAUUUCUACUACUUUUUUUUCGCGUGUAUAAACGUGCAACAAAUC ......(((((.......))))).........(((((......)))))......... ( -6.50, z-score = -0.95, R) >droMoj3.scaffold_6680 15328637 54 - 24764193 UAGUCUCGAAAUGUCUGUGGGCCCCAUAGUCUCGCCGCUGCAGCUGU-CGACGUC-- ..(((.......(.((((((...)))))).)..((.((....)).))-.)))...-- ( -11.00, z-score = 0.75, R) >consensus UAUUAUCAGUAUAAUUGCUUCUACAUUUUUUCUGCGUGUAUGAACGUGCAACAAAUC ...............................((((((((....))))))))...... ( -4.26 = -4.32 + 0.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:05:15 2011