| Sequence ID | dm3.chr3L |
|---|---|
| Location | 5,191,965 – 5,192,025 |
| Length | 60 |
| Max. P | 0.500000 |
| Location | 5,191,965 – 5,192,025 |
|---|---|
| Length | 60 |
| Sequences | 8 |
| Columns | 77 |
| Reading direction | forward |
| Mean pairwise identity | 79.24 |
| Shannon entropy | 0.35393 |
| G+C content | 0.34345 |
| Mean single sequence MFE | -12.16 |
| Consensus MFE | -5.91 |
| Energy contribution | -5.94 |
| Covariance contribution | 0.03 |
| Combinations/Pair | 1.14 |
| Mean z-score | -2.05 |
| Structure conservation index | 0.49 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.01 |
| SVM RNA-class probability | 0.500000 |
| Prediction | OTHER |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 5191965 60 + 24543557 UGCACAAUUUGUGUAAACAUUUAUUACGCACUCCAAG-----------------GGAAACUUUUCUCGAAUAAUUUU (((((.....))))).....(((((.((......(((-----------------(....))))...))))))).... ( -8.60, z-score = -1.35, R) >droSim1.chr3L 4714802 60 + 22553184 UGCCCAAUUUGCGUAAACAUUUAUUACGCACUCCAAG-----------------GGAAACUUUUCUCGAAUAAUUUU ..(((....(((((((.......)))))))......)-----------------))..................... ( -10.40, z-score = -1.96, R) >droSec1.super_2 5145819 60 + 7591821 UGCCCAAUUUGCGUAAACAUUUAUUACGCACUCCAAG-----------------GGAAACUUUUCUCGAAUAAUUUU ..(((....(((((((.......)))))))......)-----------------))..................... ( -10.40, z-score = -1.96, R) >droYak2.chr3L 5753694 60 + 24197627 UGCCCAAUUUGCGUAAACAUUUAUUACGCACUCCAAG-----------------GGAAACUUUUCUCGAAUAAUUUU ..(((....(((((((.......)))))))......)-----------------))..................... ( -10.40, z-score = -1.96, R) >droEre2.scaffold_4784 7885591 60 + 25762168 UGCCCAAUUUGCGUAAACAUUUAUUACGCACUCCAAG-----------------GGAAACUUUUCUCGAAUAAUUUU ..(((....(((((((.......)))))))......)-----------------))..................... ( -10.40, z-score = -1.96, R) >droAna3.scaffold_13337 9949220 60 - 23293914 UGCCCAAUUUGCGUAAACAUUUAUUACACACUCCAUG-----------------AGAAACUUUUCUCGAAUUAUUUU .........((.((((.......)))).)).....((-----------------((((....))))))......... ( -6.00, z-score = -1.57, R) >droVir3.scaffold_13049 7920629 77 + 25233164 UAUGCAAUUUGCGUAAACAUUUAUUACGCACUCAAAACUGCUGCAAAAGUUGCAUGCAACUUUUUGUAGCAAGUUCU .........(((((((.......))))))).....(((((((((((((((((....)))).))))))))).)))).. ( -24.40, z-score = -3.41, R) >droMoj3.scaffold_6680 11574465 66 + 24764193 UAUGCAAUUUGCGUAAACAUUUAUUACGCACUCAAAA-----------GUUGCAUGCAACUUUCUGCAGCAAGUUCU ..((((...(((((((.......)))))))....(((-----------((((....))))))).))))......... ( -16.70, z-score = -2.21, R) >consensus UGCCCAAUUUGCGUAAACAUUUAUUACGCACUCCAAG_________________GGAAACUUUUCUCGAAUAAUUUU .........(((((((.......)))))))............................................... ( -5.91 = -5.94 + 0.03)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:04:29 2011