| Sequence ID | dm3.chr3L |
|---|---|
| Location | 5,066,121 – 5,066,174 |
| Length | 53 |
| Max. P | 0.971580 |
| Location | 5,066,121 – 5,066,174 |
|---|---|
| Length | 53 |
| Sequences | 7 |
| Columns | 58 |
| Reading direction | forward |
| Mean pairwise identity | 75.84 |
| Shannon entropy | 0.47022 |
| G+C content | 0.35103 |
| Mean single sequence MFE | -11.31 |
| Consensus MFE | -5.36 |
| Energy contribution | -6.81 |
| Covariance contribution | 1.45 |
| Combinations/Pair | 1.30 |
| Mean z-score | -2.49 |
| Structure conservation index | 0.47 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.85 |
| SVM RNA-class probability | 0.971580 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 5066121 53 + 24543557 CACAGCA-ACAACCAUGUCUAUGAAAUAUCAUGGACAUAUAA----AAAAUGCAGUGC (((.(((-......((((((((((....))))))))))....----....))).))). ( -15.04, z-score = -4.04, R) >droSim1.chr3L 4600999 57 + 22553184 GACAGCA-ACAACCAUGUCUAUGAAAUAUCAUGGACAUAUGUAUAAAAAAUGCAGUGC ....(((-......((((((((((....)))))))))).(((((.....))))).))) ( -15.50, z-score = -3.38, R) >droSec1.super_2 5031945 57 + 7591821 GACAGCA-ACAACCAUGUCUAUGAAAUAUCAUGGACAUAUGUAUAAAAAAUGCAGUGC ....(((-......((((((((((....)))))))))).(((((.....))))).))) ( -15.50, z-score = -3.38, R) >droYak2.chr3L 5638558 53 + 24197627 GACAGCA-ACAACCAUGUCUAUGAAAUAUCAUGGACAUAUAC----AAAAUGCAUGGC ..(((((-......((((((((((....))))))))))....----....))).)).. ( -13.64, z-score = -3.21, R) >droEre2.scaffold_4784 7769023 51 + 25762168 GACAGCA--CAACUAUGUCUAUGAAAUAUCAUGGAGGUAUA-----AAAAUGCAGGGC ....(((--....(((.(((((((....))))))).)))..-----....)))..... ( -11.40, z-score = -2.44, R) >droAna3.scaffold_13337 3144744 51 + 23293914 GACACCA-GCAACCAGGUCUAUAAAAUAUCA--AAUAUAUGA----AAAAUUCAGUAA .(((((.-.......)))..........(((--......)))----........)).. ( -1.40, z-score = 0.70, R) >apiMel3.Group6 12511714 54 - 14581788 CAAAGCAUAAAAUCGAUUCGAUGAAAUAUGCAGAAUCCAUAC----AAAAUCCAGUCU ....(((((..((((...))))....)))))...........----............ ( -6.70, z-score = -1.68, R) >consensus GACAGCA_ACAACCAUGUCUAUGAAAUAUCAUGGACAUAUAA____AAAAUGCAGUGC ..............((((((((((....)))))))))).................... ( -5.36 = -6.81 + 1.45)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:04:11 2011