| Sequence ID | dm3.chr3L |
|---|---|
| Location | 4,977,581 – 4,977,640 |
| Length | 59 |
| Max. P | 0.906011 |
| Location | 4,977,581 – 4,977,640 |
|---|---|
| Length | 59 |
| Sequences | 9 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 94.87 |
| Shannon entropy | 0.11497 |
| G+C content | 0.30805 |
| Mean single sequence MFE | -12.31 |
| Consensus MFE | -11.26 |
| Energy contribution | -11.40 |
| Covariance contribution | 0.14 |
| Combinations/Pair | 1.15 |
| Mean z-score | -1.43 |
| Structure conservation index | 0.91 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.43 |
| SVM RNA-class probability | 0.692427 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 4977581 59 + 24543557 UGUAUAAAUUAUGCAAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((((((((..(.((((..............)))).)..)))))))). ( -12.84, z-score = -1.75, R) >droSim1.chr3L 4522907 59 + 22553184 UGUAUAAAUUAUGCAAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((((((((..(.((((..............)))).)..)))))))). ( -12.84, z-score = -1.75, R) >droSec1.super_2 4957661 59 + 7591821 UGUAUAAAUUAUGCAAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((((((((..(.((((..............)))).)..)))))))). ( -12.84, z-score = -1.75, R) >droYak2.chr3L 5560563 59 + 24197627 UGUAUAAAUUAUGCAAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((((((((..(.((((..............)))).)..)))))))). ( -12.84, z-score = -1.75, R) >droEre2.scaffold_4784 7689040 59 + 25762168 UGUAUAAAUUAUGCAAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((((((((..(.((((..............)))).)..)))))))). ( -12.84, z-score = -1.75, R) >droAna3.scaffold_13337 3068018 59 + 23293914 UGUAUAAAUUAUGCAAUUUAUAAGCUGCAUAUUUUAUAGGUCGCAGGUCGUAAAUUGUU ............((((((((..(.((((..............)))).)..)))))))). ( -12.84, z-score = -1.65, R) >dp4.chrXR_group8 3135562 59 + 9212921 UGUAUAAAUUAUGCCAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((.(((((..(.((((..............)))).)..))))).)). ( -8.74, z-score = 0.37, R) >droPer1.super_209 17094 59 - 64652 UGUAUAAAUUAUGCCAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((.(((((..(.((((..............)))).)..))))).)). ( -8.74, z-score = 0.37, R) >droMoj3.scaffold_6680 1792911 54 + 24764193 UGUAUAAAUUAUGCAGCUUAUGAGCUGCAUGUUUAAU-----GUAGGUCGUAAAUUGUU ............((((.((((((.((((((.....))-----)))).)))))).)))). ( -16.30, z-score = -3.21, R) >consensus UGUAUAAAUUAUGCAAUUUAUAAGCUGCAUAUUUUAUGGGUCGCAGGUCGUAAAUUGUU ............((((((((..(.((((..............)))).)..)))))))). (-11.26 = -11.40 + 0.14)
| Location | 4,977,581 – 4,977,640 |
|---|---|
| Length | 59 |
| Sequences | 9 |
| Columns | 59 |
| Reading direction | reverse |
| Mean pairwise identity | 94.87 |
| Shannon entropy | 0.11497 |
| G+C content | 0.30805 |
| Mean single sequence MFE | -8.87 |
| Consensus MFE | -7.14 |
| Energy contribution | -7.49 |
| Covariance contribution | 0.35 |
| Combinations/Pair | 1.08 |
| Mean z-score | -2.44 |
| Structure conservation index | 0.81 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.18 |
| SVM RNA-class probability | 0.906011 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 4977581 59 - 24543557 AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUUGCAUAAUUUAUACA ..(((((((..(.(((((............))))).)..)))))))............. ( -9.40, z-score = -2.90, R) >droSim1.chr3L 4522907 59 - 22553184 AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUUGCAUAAUUUAUACA ..(((((((..(.(((((............))))).)..)))))))............. ( -9.40, z-score = -2.90, R) >droSec1.super_2 4957661 59 - 7591821 AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUUGCAUAAUUUAUACA ..(((((((..(.(((((............))))).)..)))))))............. ( -9.40, z-score = -2.90, R) >droYak2.chr3L 5560563 59 - 24197627 AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUUGCAUAAUUUAUACA ..(((((((..(.(((((............))))).)..)))))))............. ( -9.40, z-score = -2.90, R) >droEre2.scaffold_4784 7689040 59 - 25762168 AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUUGCAUAAUUUAUACA ..(((((((..(.(((((............))))).)..)))))))............. ( -9.40, z-score = -2.90, R) >droAna3.scaffold_13337 3068018 59 - 23293914 AACAAUUUACGACCUGCGACCUAUAAAAUAUGCAGCUUAUAAAUUGCAUAAUUUAUACA ..(((((((..(.(((((............))))).)..)))))))............. ( -9.40, z-score = -2.21, R) >dp4.chrXR_group8 3135562 59 - 9212921 AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUGGCAUAAUUUAUACA ....(((((..(.(((((............))))).)..)))))............... ( -6.00, z-score = -0.46, R) >droPer1.super_209 17094 59 + 64652 AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUGGCAUAAUUUAUACA ....(((((..(.(((((............))))).)..)))))............... ( -6.00, z-score = -0.46, R) >droMoj3.scaffold_6680 1792911 54 - 24764193 AACAAUUUACGACCUAC-----AUUAAACAUGCAGCUCAUAAGCUGCAUAAUUUAUACA .................-----.......((((((((....)))))))).......... ( -11.40, z-score = -4.35, R) >consensus AACAAUUUACGACCUGCGACCCAUAAAAUAUGCAGCUUAUAAAUUGCAUAAUUUAUACA ......................(((((.(((((((........))))))).)))))... ( -7.14 = -7.49 + 0.35)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:04:00 2011