| Sequence ID | dm3.chr3L |
|---|---|
| Location | 4,609,681 – 4,609,765 |
| Length | 84 |
| Max. P | 0.784444 |
| Location | 4,609,681 – 4,609,765 |
|---|---|
| Length | 84 |
| Sequences | 4 |
| Columns | 84 |
| Reading direction | forward |
| Mean pairwise identity | 81.94 |
| Shannon entropy | 0.29199 |
| G+C content | 0.43999 |
| Mean single sequence MFE | -25.12 |
| Consensus MFE | -17.34 |
| Energy contribution | -17.15 |
| Covariance contribution | -0.19 |
| Combinations/Pair | 1.28 |
| Mean z-score | -1.82 |
| Structure conservation index | 0.69 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.50 |
| SVM RNA-class probability | 0.719219 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 4609681 84 + 24543557 GUUCCCAUUGCAACGCCAAUGCCGUUGCAGCUGCAGUUGCAGUCUGCUGUCUGAAUGCAGACAUAAACAACAAUUUAGAGGAAU ((((((..((((((((...(((....)))...)).))))))((((((.........))))))...............).))))) ( -26.30, z-score = -1.98, R) >droSim1.chr3L 4141200 84 + 22553184 GUUCCCAUUGCAACGCCAUUGCCGUUGCAGCUGCAGUUGCAGUCUGCUGUCUGAAUGCAGACAUAAACAACAAUUUAGAGGAAU ((((((..((((((((..((((....))))..)).))))))((((((.........))))))...............).))))) ( -26.70, z-score = -2.06, R) >droSec1.super_2 4591374 84 + 7591821 GUUCCCAUUGCAACGCCAUUGCCGUUGCAGCUGCAGUUGCAGUCUGCUGUCUGAAUGCAGACAUAAACAACAAUUUAGAGGAAU ((((((..((((((((..((((....))))..)).))))))((((((.........))))))...............).))))) ( -26.70, z-score = -2.06, R) >droGri2.scaffold_14906 1837923 79 + 14172833 -UUCUCAAUUGAAU-UAAAUGCAGUGGCAGUUGCAGUUGCAGUUUGCAGUUUGCAUUUUCAUGCGAACAA---UUUCAAGGAAU -((((...(((((.-....(((((..((((......))))...)))))((((((((....))))))))..---.))))))))). ( -20.80, z-score = -1.18, R) >consensus GUUCCCAUUGCAACGCCAAUGCCGUUGCAGCUGCAGUUGCAGUCUGCUGUCUGAAUGCAGACAUAAACAACAAUUUAGAGGAAU (((((.....................((((((((....)))).)))).(((((....))))).................))))) (-17.34 = -17.15 + -0.19)
| Location | 4,609,681 – 4,609,765 |
|---|---|
| Length | 84 |
| Sequences | 4 |
| Columns | 84 |
| Reading direction | reverse |
| Mean pairwise identity | 81.94 |
| Shannon entropy | 0.29199 |
| G+C content | 0.43999 |
| Mean single sequence MFE | -26.00 |
| Consensus MFE | -15.85 |
| Energy contribution | -18.60 |
| Covariance contribution | 2.75 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.21 |
| Structure conservation index | 0.61 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.68 |
| SVM RNA-class probability | 0.784444 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 4609681 84 - 24543557 AUUCCUCUAAAUUGUUGUUUAUGUCUGCAUUCAGACAGCAGACUGCAACUGCAGCUGCAACGGCAUUGGCGUUGCAAUGGGAAC .(((((.......((((((..((((((....))))))((((.((((....))))))))))))))((((......))))))))). ( -28.60, z-score = -2.21, R) >droSim1.chr3L 4141200 84 - 22553184 AUUCCUCUAAAUUGUUGUUUAUGUCUGCAUUCAGACAGCAGACUGCAACUGCAGCUGCAACGGCAAUGGCGUUGCAAUGGGAAC .(((((....(((((((((..((((((....))))))((((.((((....))))))))))))))))).((...))...))))). ( -30.30, z-score = -2.81, R) >droSec1.super_2 4591374 84 - 7591821 AUUCCUCUAAAUUGUUGUUUAUGUCUGCAUUCAGACAGCAGACUGCAACUGCAGCUGCAACGGCAAUGGCGUUGCAAUGGGAAC .(((((....(((((((((..((((((....))))))((((.((((....))))))))))))))))).((...))...))))). ( -30.30, z-score = -2.81, R) >droGri2.scaffold_14906 1837923 79 - 14172833 AUUCCUUGAAA---UUGUUCGCAUGAAAAUGCAAACUGCAAACUGCAACUGCAACUGCCACUGCAUUUA-AUUCAAUUGAGAA- .(((.(((((.---..(((.((((....)))).)))((((....(((........)))...))))....-.)))))..)))..- ( -14.80, z-score = -1.02, R) >consensus AUUCCUCUAAAUUGUUGUUUAUGUCUGCAUUCAGACAGCAGACUGCAACUGCAGCUGCAACGGCAAUGGCGUUGCAAUGGGAAC .(((((((((..(((((((..((((((....))))))((((.((((....))))))))))))))))))).........))))). (-15.85 = -18.60 + 2.75)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:03:09 2011