| Sequence ID | dm3.chr3L |
|---|---|
| Location | 4,408,124 – 4,408,180 |
| Length | 56 |
| Max. P | 0.999183 |
| Location | 4,408,124 – 4,408,180 |
|---|---|
| Length | 56 |
| Sequences | 8 |
| Columns | 64 |
| Reading direction | forward |
| Mean pairwise identity | 73.79 |
| Shannon entropy | 0.49921 |
| G+C content | 0.32108 |
| Mean single sequence MFE | -8.83 |
| Consensus MFE | -6.16 |
| Energy contribution | -6.43 |
| Covariance contribution | 0.27 |
| Combinations/Pair | 1.11 |
| Mean z-score | -2.86 |
| Structure conservation index | 0.70 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 3.69 |
| SVM RNA-class probability | 0.999183 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 4408124 56 + 24543557 -UUUCGCUGAUUAACAUCUUAAUUAGCCUUGCAAUUAUU---UCCUCAACUAUAAUAUUA---- -....(((((((((....)))))))))............---..................---- ( -7.70, z-score = -3.15, R) >droPer1.super_24 1006661 55 - 1556852 UUGUCGCUGAUUAACAUCUUAAUUAGCCUUGCAGCAUUUAUUUCCUAUGCGAUAA--------- .(((((((((((((....)))))))))......((((.........)))))))).--------- ( -13.30, z-score = -2.96, R) >droAna3.scaffold_13337 2488331 54 + 23293914 -UUGCGCUGAUUAAUAUCUUAAUGAGCCUUGCAAUUAUUAUUUCCUCGUCUAAAC--------- -(((((((.(((((....))))).)))...)))).....................--------- ( -8.10, z-score = -1.76, R) >droEre2.scaffold_4784 7116792 51 + 25762168 -UUUCGCUGAUUAACAUCUUAAUUAGCCUUGCAAUUAUU---UCCUCAACUGCUG--------- -....(((((((((....)))))))))...(((.((...---.....)).)))..--------- ( -8.30, z-score = -2.76, R) >droYak2.chr3L 4984044 51 + 24197627 -UUUCGCUGAUUAACAUCUUAAUUAGCCUUGCAAUUAUU---UCCUCAAAUGUGU--------- -....(((((((((....)))))))))............---.............--------- ( -7.70, z-score = -2.13, R) >droSec1.super_2 4397404 51 + 7591821 -UUUCGCUGAUUAACAUCUUAAUUAGCCUUGCAAUUAUU---UCCUCAACUAACA--------- -....(((((((((....)))))))))............---.............--------- ( -7.70, z-score = -3.82, R) >droSim1.chr3L 3944691 51 + 22553184 -UUUCGCUGAUUAACAUCUUAAUUAGCCUUGCAAUUAUU---UCCUCAACUAACA--------- -....(((((((((....)))))))))............---.............--------- ( -7.70, z-score = -3.82, R) >droVir3.scaffold_13049 25184716 61 - 25233164 -UUUUGCUGAUUUGCACCUUAAUUAACCUUUUCAUGCGU--UUCCUGUAGAAACUGUGAAAUUA -...(((......))).............(((((((.((--(((.....))))))))))))... ( -10.10, z-score = -2.51, R) >consensus _UUUCGCUGAUUAACAUCUUAAUUAGCCUUGCAAUUAUU___UCCUCAACUAAAA_________ .....(((((((((....)))))))))..................................... ( -6.16 = -6.43 + 0.27)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:02:42 2011