| Sequence ID | dm3.chr3L |
|---|---|
| Location | 3,886,435 – 3,886,533 |
| Length | 98 |
| Max. P | 0.785324 |
| Location | 3,886,435 – 3,886,533 |
|---|---|
| Length | 98 |
| Sequences | 5 |
| Columns | 98 |
| Reading direction | forward |
| Mean pairwise identity | 94.49 |
| Shannon entropy | 0.09602 |
| G+C content | 0.32245 |
| Mean single sequence MFE | -22.63 |
| Consensus MFE | -21.26 |
| Energy contribution | -21.14 |
| Covariance contribution | -0.12 |
| Combinations/Pair | 1.11 |
| Mean z-score | -1.44 |
| Structure conservation index | 0.94 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.68 |
| SVM RNA-class probability | 0.785324 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 3886435 98 + 24543557 AUUAAAUCAGCUAACUUAAGAUUUAGUGGUGCUAAGUUGCUUAAAUAAUUGCCUAAGCUUGCUUGGGUAAUUGCACAUUAAAUCAAUCAAUGUCGGUU ........(((..((....(((((((((.(((((((...))))...(((((((((((....))))))))))))))))))))))).......))..))) ( -26.00, z-score = -2.68, R) >droYak2.chr3L 4444478 98 + 24197627 AUUAAAUCAGCUAAUCUAAGAUUUAGUGGUGCUAAGUUGCUUAAAUAAUUGCUCAAGCUUGCUUGGUUAAUUGCACAUUAAAUCAAUCAAUGUCGGUU ....((((.((........((((((((((((((((((.((((............))))..))))))).....)).))))))))).......)).)))) ( -19.06, z-score = -0.64, R) >droEre2.scaffold_4784 6585036 98 + 25762168 AUUAAUUCAGCUGACUUAAGAUUUAGUGGUGCUAAGUUGCUUAAAUAAUUGCUCAAGCUUGCUUGGGUAAUUGCACAUUAAAUCAAUCAAUGUCGGUU ........(((((((....(((((((((.(((((((...))))...(((((((((((....))))))))))))))))))))))).......))))))) ( -30.10, z-score = -3.92, R) >droSec1.super_2 3879696 98 + 7591821 AUUAAAUAAGCUAACUUAAGAUUUAGUGGUGCUAAGUUGCUUAAAUAAUUGCCUAAGCUUGCCUGGGUAAUUGCACAUUAAAUUAAUCAAUGUCGGUU ........(((..((....(((((((((.(((((((...))))...(((((((((.(....).))))))))))))))))))))).......))..))) ( -20.10, z-score = -0.46, R) >droSim1.chr3L_random 185565 98 + 1049610 AUUAAAUCAGCUAACUUAAGAUUUAGUGGUGCUAAGUUGCUUAAAUAAUUGGCUAAGCUUGCUUGGGUAAUUGCACAUUAAAUUAAUCAAUGUCGCUU ........(((........(((((((((.(((((((...))))...(((((.(((((....))))).)))))))))))))))))..........))). ( -17.87, z-score = 0.48, R) >consensus AUUAAAUCAGCUAACUUAAGAUUUAGUGGUGCUAAGUUGCUUAAAUAAUUGCCUAAGCUUGCUUGGGUAAUUGCACAUUAAAUCAAUCAAUGUCGGUU ...................(((((((((.(((((((...))))...(((((((((((....))))))))))))))))))))))).............. (-21.26 = -21.14 + -0.12)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:01:42 2011