| Sequence ID | dm3.chr3L |
|---|---|
| Location | 3,852,361 – 3,852,415 |
| Length | 54 |
| Max. P | 0.959203 |
| Location | 3,852,361 – 3,852,415 |
|---|---|
| Length | 54 |
| Sequences | 7 |
| Columns | 60 |
| Reading direction | reverse |
| Mean pairwise identity | 75.34 |
| Shannon entropy | 0.47298 |
| G+C content | 0.39824 |
| Mean single sequence MFE | -12.86 |
| Consensus MFE | -8.59 |
| Energy contribution | -8.50 |
| Covariance contribution | -0.09 |
| Combinations/Pair | 1.47 |
| Mean z-score | -1.64 |
| Structure conservation index | 0.67 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.66 |
| SVM RNA-class probability | 0.959203 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 3852361 54 - 24543557 GCUG-UCAGUUUUCAAUUU--AAGCCGCUAAGUGGCUAAUUGACAAUUGCCGAAAAG--- ..((-.(((((.((((((.--.((((((...)))))))))))).))))).)).....--- ( -15.30, z-score = -2.66, R) >droSim1.chr3L 3392141 54 - 22553184 GCUG-UCAGUUUUCAAUUU--GAGCCGCUAAGUGGCUAAUUGACAAUUGCCGAAAAG--- ..((-.(((((.((((((.--.((((((...)))))))))))).))))).)).....--- ( -15.30, z-score = -2.29, R) >droSec1.super_2 3846142 54 - 7591821 GCUG-UCAGUUUUCAAUUU--GAGCCGCUAAGUGGCUAAUUGACAAUUGCCGAAAAG--- ..((-.(((((.((((((.--.((((((...)))))))))))).))))).)).....--- ( -15.30, z-score = -2.29, R) >droYak2.chr3L 4409933 54 - 24197627 GCUG-UCAGUUUUCAAUUU--AAGCCGCUAAGUGGCUAAUUGACAAUUGCCAAAAAG--- ..((-.(((((.((((((.--.((((((...)))))))))))).))))).)).....--- ( -16.00, z-score = -3.26, R) >droEre2.scaffold_4784 6550081 54 - 25762168 GCUG-UCAGUUUUCAAUUU--GAGCCGCUAAGUGGCUAAUUGACAAUUGUCCCAAAG--- ...(-.(((((.((((((.--.((((((...)))))))))))).))))).)......--- ( -15.40, z-score = -2.92, R) >droAna3.scaffold_13337 13704213 60 + 23293914 GCUGCUUGUUUUUCAAUUUUCCGGGUGCUAAAUACUUUAUUGACAAUUGCCGAAAAAAAG ....(((.((((((((((.((.(((((.....)))))....)).)))))..))))).))) ( -4.20, z-score = 1.63, R) >droWil1.scaffold_180955 1783116 55 - 2875958 -UUUUUUUGCAUUCAAGCU-GCAGCUGGCAGUUAAUCUUUUCUCAAUUGCUAACAAG--- -......((((.......)-)))(.((((((((...........)))))))).)...--- ( -8.50, z-score = 0.33, R) >consensus GCUG_UCAGUUUUCAAUUU__GAGCCGCUAAGUGGCUAAUUGACAAUUGCCGAAAAG___ ......(((((.((((((....((((((...)))))))))))).)))))........... ( -8.59 = -8.50 + -0.09)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:01:37 2011