| Sequence ID | dm3.chr3L |
|---|---|
| Location | 3,532,320 – 3,532,370 |
| Length | 50 |
| Max. P | 0.972145 |
| Location | 3,532,320 – 3,532,370 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 58 |
| Reading direction | reverse |
| Mean pairwise identity | 59.64 |
| Shannon entropy | 0.53397 |
| G+C content | 0.38526 |
| Mean single sequence MFE | -12.20 |
| Consensus MFE | -6.75 |
| Energy contribution | -6.20 |
| Covariance contribution | -0.55 |
| Combinations/Pair | 1.45 |
| Mean z-score | -1.83 |
| Structure conservation index | 0.55 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.86 |
| SVM RNA-class probability | 0.972145 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 3532320 50 - 24543557 AGCCAUGGGAAAAGGCGAAAUAU--GACGUCUGUAUGGUGUGAAAAUUAGAA------ .((((((.....(((((......--..))))).)))))).............------ ( -10.20, z-score = -2.01, R) >droWil1.scaffold_180955 1330757 57 - 2875958 AUUUAU-GCAAGAUGCUAGAUGCUAGAUGCAUGUGUGCAUUUUCAAGUAAUUUUACAA .....(-(.(((((((((.((((.....)))).)).))))))))).(((....))).. ( -13.50, z-score = -0.98, R) >droSec1.super_2 3524225 50 - 7591821 AGCCAUGGGAAAAGGCGAAAUAU--GACGCCUGUAUGGUGUGAAAAUUAGGA------ .((((((.....(((((......--..))))).)))))).............------ ( -12.90, z-score = -2.49, R) >consensus AGCCAUGGGAAAAGGCGAAAUAU__GACGCCUGUAUGGUGUGAAAAUUAGAA______ .((((((.....(((((..........))))).))))))................... ( -6.75 = -6.20 + -0.55)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:01:02 2011