Sequence ID | dm3.chr3L |
---|---|
Location | 3,514,008 – 3,514,062 |
Length | 54 |
Max. P | 0.795262 |
Location | 3,514,008 – 3,514,062 |
---|---|
Length | 54 |
Sequences | 6 |
Columns | 54 |
Reading direction | forward |
Mean pairwise identity | 91.73 |
Shannon entropy | 0.15590 |
G+C content | 0.56837 |
Mean single sequence MFE | -22.05 |
Consensus MFE | -19.68 |
Energy contribution | -19.93 |
Covariance contribution | 0.25 |
Combinations/Pair | 1.19 |
Mean z-score | -1.59 |
Structure conservation index | 0.89 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.71 |
SVM RNA-class probability | 0.795262 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 3514008 54 + 24543557 UGGCCCUUUUGGCCAACAAGAGGUCUGCAAACAGGCCAAACCUGCAAGGGCCAA (((((((((((.....)))))((((((....))))))..........)))))). ( -23.50, z-score = -2.12, R) >droAna3.scaffold_13337 13368537 53 - 23293914 GGGCCCUUUUGGCCAAGAAGAUCUCUGCAAACAGGCCCCACCAGCA-GGGCUAA .((((((.((((...(((.....)))((......))....)))).)-))))).. ( -15.50, z-score = 0.61, R) >droEre2.scaffold_4784 6208052 54 + 25762168 GGGCUCUUUUGGCCAACAAGAGGCCUGCAAACAGGCCAAACCUGCAAGGGCCAA .((((((((((.....)))))((((((....))))))..........))))).. ( -22.50, z-score = -1.50, R) >droYak2.chr3L 4064897 54 + 24197627 GGGCCCUUUUGGCCAACAAGAGGUCUGCAAACAGGCCAAACCUGCAAGGGCCAA .((((((((((.....)))))((((((....))))))..........))))).. ( -22.80, z-score = -1.59, R) >droSec1.super_2 3505815 54 + 7591821 UGGCCCUUUUGGCCAACAAGAGGUCUGCAAACAGGCCAAACCAGCAAGGGCCAA ((((((((((((.(.....).((((((....))))))...)))).)))))))). ( -24.70, z-score = -2.86, R) >droSim1.chr3L 3051906 53 + 22553184 UGGCCCUUUUGGCCAACA-GAGGUCUGCAAACAGGCCAAACCUGCAAGGGCCAA (((((((((((.....))-))((((((....)))))).........))))))). ( -23.30, z-score = -2.07, R) >consensus GGGCCCUUUUGGCCAACAAGAGGUCUGCAAACAGGCCAAACCUGCAAGGGCCAA .((((((((((.....)))))((((((....))))))..........))))).. (-19.68 = -19.93 + 0.25)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:00:58 2011