| Sequence ID | dm3.chr3L |
|---|---|
| Location | 2,910,040 – 2,910,092 |
| Length | 52 |
| Max. P | 0.872627 |
| Location | 2,910,040 – 2,910,092 |
|---|---|
| Length | 52 |
| Sequences | 6 |
| Columns | 52 |
| Reading direction | reverse |
| Mean pairwise identity | 85.13 |
| Shannon entropy | 0.29081 |
| G+C content | 0.34615 |
| Mean single sequence MFE | -11.37 |
| Consensus MFE | -7.91 |
| Energy contribution | -8.88 |
| Covariance contribution | 0.97 |
| Combinations/Pair | 1.18 |
| Mean z-score | -2.06 |
| Structure conservation index | 0.70 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.01 |
| SVM RNA-class probability | 0.872627 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 2910040 52 - 24543557 GCAUGAGGAAAUGUUUUCCAUGGAAAUGGAAAAUUUGCCAUUAGUAAUAAGU ......((....(((((((((....)))))))))...))............. ( -13.90, z-score = -3.19, R) >droAna3.scaffold_13337 14115110 52 + 23293914 GCACAAGAAACGCCUCUUUAUGGAAUCGGAAAUUUUCCCAUUAGCGAGAAGU ..........(((.(((....)))...(((.....))).....)))...... ( -5.40, z-score = 0.98, R) >droEre2.scaffold_4784 2939886 52 - 25762168 GCAUGAGCCAAUGUUUUCCAUGGAAAUGGAAAAUUCACCAUUAGUAGUAAGU ((.(((......(((((((((....)))))))))......)))))....... ( -11.30, z-score = -1.88, R) >droYak2.chr3L 15179411 52 + 24197627 GCAUGAGGAAAUGUUUUCCAUGGAAAUGGAAAAAUUGCCAUUAGUAAUAAGU ......((.....((((((((....))))))))....))............. ( -12.70, z-score = -2.84, R) >droSec1.super_2 2929943 52 - 7591821 GCAUGAGGAAAUGUUUUCCAUGGAAAUGGAAAAUUUGCCAUUAGUAAUAAGU ......((....(((((((((....)))))))))...))............. ( -13.90, z-score = -3.19, R) >droSim1.chr3L 2462656 52 - 22553184 GCAUGAGGAAAUGUUUUUCAUGGAAAUGGAAAAUUUGCCAUUAGUAAUAAGU ......((....(((((((((....)))))))))...))............. ( -11.00, z-score = -2.22, R) >consensus GCAUGAGGAAAUGUUUUCCAUGGAAAUGGAAAAUUUGCCAUUAGUAAUAAGU ......((....(((((((((....)))))))))...))............. ( -7.91 = -8.88 + 0.97)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:59:00 2011