| Sequence ID | dm3.chr3L |
|---|---|
| Location | 2,838,684 – 2,838,743 |
| Length | 59 |
| Max. P | 0.711112 |
| Location | 2,838,684 – 2,838,743 |
|---|---|
| Length | 59 |
| Sequences | 4 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 96.05 |
| Shannon entropy | 0.06140 |
| G+C content | 0.48305 |
| Mean single sequence MFE | -13.85 |
| Consensus MFE | -13.90 |
| Energy contribution | -14.40 |
| Covariance contribution | 0.50 |
| Combinations/Pair | 1.00 |
| Mean z-score | -0.97 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.48 |
| SVM RNA-class probability | 0.711112 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 2838684 59 + 24543557 GCAACAACACGAAGCAGCAACGCAGCCACGUUUUAAUGGAACAUUAAAAGCAGCUUGCG ((..(.....)..)).((((.((.((....((((((((...)))))))))).)))))). ( -11.10, z-score = -0.28, R) >droSec1.super_2 2859031 59 + 7591821 GCAACAACACGAAGCGGCAACGCUGCCACGUUUUAAUGGAACAUUAAAAGCAGCUUGCG ((..(.....)..)).((((.(((((....((((((((...))))))))))))))))). ( -16.20, z-score = -1.70, R) >droYak2.chr3L 15102934 59 - 24197627 GCAACAACAUGAGGCAGCAACGCAGCCACGUUUUAAUGGAACAUUAAAAGCAGCUUGCG ((..(.....)..)).((((.((.((....((((((((...)))))))))).)))))). ( -11.90, z-score = -0.21, R) >droEre2.scaffold_4784 2864699 59 + 25762168 GCAACAACACGAAGCGGCAACGCUGCCACGUUUUAAUGGAACAUUAAAAGCAGCUUGCG ((..(.....)..)).((((.(((((....((((((((...))))))))))))))))). ( -16.20, z-score = -1.70, R) >consensus GCAACAACACGAAGCAGCAACGCAGCCACGUUUUAAUGGAACAUUAAAAGCAGCUUGCG ((..(.....)..)).((((.(((((....((((((((...))))))))))))))))). (-13.90 = -14.40 + 0.50)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:58:43 2011