Sequence ID | dm3.chr3L |
---|---|
Location | 1,677,955 – 1,678,045 |
Length | 90 |
Max. P | 0.672047 |
Location | 1,677,955 – 1,678,045 |
---|---|
Length | 90 |
Sequences | 4 |
Columns | 106 |
Reading direction | reverse |
Mean pairwise identity | 85.33 |
Shannon entropy | 0.22436 |
G+C content | 0.58710 |
Mean single sequence MFE | -39.15 |
Consensus MFE | -28.34 |
Energy contribution | -29.77 |
Covariance contribution | 1.44 |
Combinations/Pair | 1.07 |
Mean z-score | -1.95 |
Structure conservation index | 0.72 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.39 |
SVM RNA-class probability | 0.672047 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 1677955 90 - 24543557 GCUGUGUGUGCGAUCGCGAUCAUAUCGGAUACACUG------------GGAUUGGGAUUGGUACUGGGAU----AUCGGGAUAGCUUUGUGAUCGCUGCGCGGCCG ((((((((.((((((((((...((((.((((..(..------------(.(((......))).)..)..)----)))..))))...)))))))))))))))))).. ( -36.60, z-score = -2.91, R) >droSim1.chr3L 1238973 94 - 22553184 GCUGUGUGUGCGAUCGCGAUCAUAUCGGAUCCACUG------------GGACUCGGAUUGGGACAGGGAUCGGGAUCGGGAUAGCUUUGUGAUCGCUGAGCGGCCG (((((....((((((((((...((((.(((((.(((------------...(((.....))).))))))))(....)..))))...))))))))))...))))).. ( -36.90, z-score = -1.30, R) >droSec1.super_2 1704405 94 - 7591821 GCUGUGUGUGCGAUCGCGAUCAUAUCGGAUCCACUG------------GGAUUCGGAUUGGGACAGGGAUCUGGAUCGGGAUAGCUUUGUGAUCGCUGAGCGGCCG (((((....((((((((((...((((((((((....------------)))))).((((.(((......))).))))..))))...))))))))))...))))).. ( -40.70, z-score = -2.72, R) >droYak2.chr3L 1629035 106 - 24197627 GCUGUGUGUGCGAUCGCGAUCAUAUCGCAUCCACUGGGAUGGGGACAUGGAUCGGGAACGGGACUGGGAUCGGGAUCGGGAUAGCUCUGUGAUCGCCGAGCGGCCG (((((.((.((((((((((((..(((.(((((.((((.(((....)))...)))).....))).)).)))...))))(((....))).)))))))))).))))).. ( -42.40, z-score = -0.84, R) >consensus GCUGUGUGUGCGAUCGCGAUCAUAUCGGAUCCACUG____________GGAUUCGGAUUGGGACAGGGAUCGGGAUCGGGAUAGCUUUGUGAUCGCUGAGCGGCCG (((((....((((((((((...(((((....).................(((((.((((........)))).)))))..))))...))))))))))...))))).. (-28.34 = -29.77 + 1.44)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:56:12 2011