| Sequence ID | dm3.chr3L |
|---|---|
| Location | 1,528,456 – 1,528,554 |
| Length | 98 |
| Max. P | 0.718179 |
| Location | 1,528,456 – 1,528,554 |
|---|---|
| Length | 98 |
| Sequences | 4 |
| Columns | 98 |
| Reading direction | reverse |
| Mean pairwise identity | 89.18 |
| Shannon entropy | 0.17452 |
| G+C content | 0.40778 |
| Mean single sequence MFE | -11.75 |
| Consensus MFE | -11.19 |
| Energy contribution | -11.00 |
| Covariance contribution | -0.19 |
| Combinations/Pair | 1.06 |
| Mean z-score | -1.07 |
| Structure conservation index | 0.95 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.49 |
| SVM RNA-class probability | 0.718179 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 1528456 98 - 24543557 AUGUAGUUACCCAUCCACUAUAACUAUAGCAUAAUCCGUAGUUGGUAGUAGUUCACCCAAAACUGCACAACCCAGAAACCCAAAAAAAAAACCCAAAC .(((((((........(((((.((((..((.......))...)))).)))))........)))))))............................... ( -12.39, z-score = -1.69, R) >droSim1.chr3L 1110783 96 - 22553184 AUGUAGUUACCCAUCCACUUUAACUAUAGCUUAAUCCGUAGUUGGUAGUAGUUCACCCAAAACUGCACAACCCAGAAACCC--AAACCAAACCCAAAC .((((((((...........))))))))............((((...((((((.......)))))).))))..........--............... ( -12.00, z-score = -0.85, R) >droSec1.super_2 1554880 96 - 7591821 AUGUAGUUACCCAUCCACUUUAACUAUAGCUUAAUCCGUAGUUGGUAGUAGUUCACCCAAAACUGCACAACCCAGAAACCC--AAAACAAACCCAAAC .((((((((...........))))))))............((((...((((((.......)))))).))))..........--............... ( -12.00, z-score = -0.81, R) >droEre2.scaffold_4784 1506575 88 - 25762168 AUGUAGUUACCCAUCCACUCUAAUUAUAGCUUAAUUCGUAGUUGGUAGAACUCCACCCAAAACUGCACAACCCAGAAACCC--AAACCAC-------- .(((((((..........((((....(((((........))))).))))...........)))))))..............--.......-------- ( -10.60, z-score = -0.92, R) >consensus AUGUAGUUACCCAUCCACUUUAACUAUAGCUUAAUCCGUAGUUGGUAGUAGUUCACCCAAAACUGCACAACCCAGAAACCC__AAAACAAACCCAAAC .((((((((...........)))))))).........(((((((((........)))...))))))................................ (-11.19 = -11.00 + -0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:55:48 2011