| Sequence ID | dm3.chr2L |
|---|---|
| Location | 4,058,131 – 4,058,184 |
| Length | 53 |
| Max. P | 0.990475 |
| Location | 4,058,131 – 4,058,184 |
|---|---|
| Length | 53 |
| Sequences | 5 |
| Columns | 53 |
| Reading direction | reverse |
| Mean pairwise identity | 95.09 |
| Shannon entropy | 0.08643 |
| G+C content | 0.30189 |
| Mean single sequence MFE | -7.42 |
| Consensus MFE | -6.96 |
| Energy contribution | -7.16 |
| Covariance contribution | 0.20 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.72 |
| Structure conservation index | 0.94 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.42 |
| SVM RNA-class probability | 0.990475 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 4058131 53 - 23011544 UAUAAUUACCAUCUUAUCUUCAAUGGUCAAAUAUUUGGCCACUUUCUCAAAGU .......................(((((((....)))))))............ ( -7.40, z-score = -2.32, R) >droSim1.chr2L 4014742 53 - 22036055 UAUAAUUACCAUCUUAUCUUCAAUGGUCAAAUAUUUGGCCACUUUCUCAAAGU .......................(((((((....)))))))............ ( -7.40, z-score = -2.32, R) >droSec1.super_5 2160108 53 - 5866729 UAUAAUUACCAUCUUAUCUUCAAUGGUCAUAUAUUUGGCCACUUUCUCAAAGU .......................((((((......))))))............ ( -7.50, z-score = -2.26, R) >droYak2.chr2L 4077649 53 - 22324452 UAUAAUUACCAUCUUAUCUUCAAUGGUCAAAUAUUUGGCCACUUUCUCAACUU .......................(((((((....)))))))............ ( -7.40, z-score = -3.26, R) >droEre2.scaffold_4929 4118690 53 - 26641161 UAUAAUUACCAUCUCUUCUUCAAUGGUCAAAUAUUUGGCCACUUUCUCAAAUA .......................(((((((....)))))))............ ( -7.40, z-score = -3.41, R) >consensus UAUAAUUACCAUCUUAUCUUCAAUGGUCAAAUAUUUGGCCACUUUCUCAAAGU .......................(((((((....)))))))............ ( -6.96 = -7.16 + 0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:15:14 2011