| Sequence ID | dm3.chr2L |
|---|---|
| Location | 4,055,103 – 4,055,194 |
| Length | 91 |
| Max. P | 0.977764 |
| Location | 4,055,103 – 4,055,194 |
|---|---|
| Length | 91 |
| Sequences | 4 |
| Columns | 100 |
| Reading direction | forward |
| Mean pairwise identity | 77.61 |
| Shannon entropy | 0.31206 |
| G+C content | 0.46895 |
| Mean single sequence MFE | -22.80 |
| Consensus MFE | -20.21 |
| Energy contribution | -20.52 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.10 |
| Mean z-score | -1.94 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.98 |
| SVM RNA-class probability | 0.977764 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 4055103 91 + 23011544 CGAUUGUGUGUGUUGUGUUUUGGU---------GCUGUUCGUUUCUCUAUCUGCCGGAAAUUGUUUUUUAAUUGGCGGGCGGGGAGGGGAACGGGUGAAA .........(..(((.....))).---------.).(..(((((((((..(((((.(.(((((.....)))))..).)))))..)))))))))..).... ( -27.60, z-score = -2.84, R) >droYak2.chr2L 4074586 82 + 22324452 ---------------CGAUUGUGUUGUGUUGCUGCUGUUCGCUUCUGUAUCUGCCGGAAAUUGUUUUUUAAUUGGUGGGCG---AGGGGAACGGGUGAAA ---------------.............(..(..((((((.((((.((..(..(((.(((......)))...)))..))))---))).)))))))..).. ( -18.80, z-score = -0.27, R) >droSec1.super_5 2157144 72 + 5866729 ---------------CGAUUGUGU---------GC-GUUCGUUUCUCUAUCUGCCGGAAAUUGUUUUUUAAUUGGCGGGCA---AGGAGAACGGGUGAAA ---------------.........---------.(-(..((((.((((...((((.(.(((((.....)))))..).))))---.))))))))..))... ( -20.80, z-score = -1.69, R) >droSim1.chr2L 4011768 72 + 22036055 ---------------CGAUUGUUU---------GC-GUUCGUUUCUCUAUCUGCCGGAAAUUGUUUUUUAAUUGGCGGGCA---AGGGGAACGGGUGAAA ---------------.........---------.(-(..(((((((((...((((.(.(((((.....)))))..).))))---)))))))))..))... ( -24.00, z-score = -2.96, R) >consensus _______________CGAUUGUGU_________GC_GUUCGUUUCUCUAUCUGCCGGAAAUUGUUUUUUAAUUGGCGGGCA___AGGGGAACGGGUGAAA ....................................(..(((((((((...((((.(.(((((.....)))))..).))))...)))))))))..).... (-20.21 = -20.52 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:15:14 2011