| Sequence ID | dm3.chr3LHet |
|---|---|
| Location | 2,421,944 – 2,421,999 |
| Length | 55 |
| Max. P | 0.903696 |
| Location | 2,421,944 – 2,421,999 |
|---|---|
| Length | 55 |
| Sequences | 3 |
| Columns | 56 |
| Reading direction | reverse |
| Mean pairwise identity | 48.80 |
| Shannon entropy | 0.71545 |
| G+C content | 0.35421 |
| Mean single sequence MFE | -8.54 |
| Consensus MFE | -4.92 |
| Energy contribution | -4.27 |
| Covariance contribution | -0.65 |
| Combinations/Pair | 1.69 |
| Mean z-score | -0.54 |
| Structure conservation index | 0.58 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.17 |
| SVM RNA-class probability | 0.903696 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3LHet 2421944 55 - 2555491 -UUAUAUUGAUUUAGAUGUGCGCUUGCAUCUGAUUGACAAAAUAAAAAAAAAAUGC -((((.(((..((((((((......))))))))....))).))))........... ( -9.70, z-score = -1.36, R) >droVir3.scaffold_12958 1396010 54 + 3547706 -UGCCGUCGACUUAGAAGUGCGCCUUUUACUAAUUGAUCAAACUAAGUCUGCCUG- -....((.(((((((...((..(..((....))..)..))..))))))).))...- ( -7.90, z-score = -0.39, R) >droMoj3.scaffold_6498 3029450 55 - 3408170 AUUCGUGUGAUUUACGUGUACUUUUGGACUCGAUCACCAAAUUAGAGUCAAAUUU- ...((((.....))))..........(((((.............)))))......- ( -8.02, z-score = 0.13, R) >consensus _UUCCAUUGAUUUAGAUGUGCGCUUGCAACUGAUUGACAAAAUAAAGUCAAAAUG_ ......((((.(((((((((....)))))))))))))................... ( -4.92 = -4.27 + -0.65)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:51:54 2011