| Sequence ID | dm3.chr3LHet |
|---|---|
| Location | 1,427,020 – 1,427,070 |
| Length | 50 |
| Max. P | 0.992260 |
| Location | 1,427,020 – 1,427,070 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 50.91 |
| Shannon entropy | 0.64794 |
| G+C content | 0.39723 |
| Mean single sequence MFE | -10.70 |
| Consensus MFE | -5.62 |
| Energy contribution | -4.97 |
| Covariance contribution | -0.65 |
| Combinations/Pair | 1.69 |
| Mean z-score | -1.73 |
| Structure conservation index | 0.53 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.53 |
| SVM RNA-class probability | 0.992260 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3LHet 1427020 50 + 2555491 ---CUGUCGUCUUUGUGGAAGUAAUCACAACAAAUUGCUCCAUUUUGGCUCAA------ ---.....(((...(((((.(((((........))))))))))...)))....------ ( -11.80, z-score = -2.20, R) >droAna3.scaffold_13099 2366962 53 - 3324263 ---UUGUCGCAGUUGUGGGAGGAGGCAUCACAGUCUGUUGCAUUU---UUUGGAGUUAC ---.(((.((((((((((.........)))))).)))).)))...---........... ( -11.60, z-score = -0.63, R) >triCas2.chrUn_16 399838 50 - 580567 UAGUUGUAAAAAUUGUGGCAACCGUCAUCAUAGUUUUUUACAUUU---CCCAA------ ....((((((((.((((((....)))).))....))))))))...---.....------ ( -8.70, z-score = -2.35, R) >consensus ___UUGUCGAAAUUGUGGAAGCAGUCAUCACAGUUUGUUACAUUU___CUCAA______ ....(((.((((((((((.........)))))).)))).)))................. ( -5.62 = -4.97 + -0.65)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:51:18 2011