| Sequence ID | dm3.chr3LHet |
|---|---|
| Location | 516,017 – 516,075 |
| Length | 58 |
| Max. P | 0.660566 |
| Location | 516,017 – 516,075 |
|---|---|
| Length | 58 |
| Sequences | 4 |
| Columns | 58 |
| Reading direction | reverse |
| Mean pairwise identity | 72.13 |
| Shannon entropy | 0.45964 |
| G+C content | 0.54470 |
| Mean single sequence MFE | -21.33 |
| Consensus MFE | -9.15 |
| Energy contribution | -9.78 |
| Covariance contribution | 0.63 |
| Combinations/Pair | 1.53 |
| Mean z-score | -1.96 |
| Structure conservation index | 0.43 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.36 |
| SVM RNA-class probability | 0.660566 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3LHet 516017 58 - 2555491 CUGGGCUGCAUGAGCAGUCCAAUUCGCUUAGGUAUGCAAAAGCUGCCUGUGUGGGCAG .((((((((....)))))))).(((((.((((((.((....)))))))).)))))... ( -25.90, z-score = -2.79, R) >droEre2.scaffold_4929 21463443 54 - 26641161 GCGGGCUUCAUGCGCGGUUUAAUUUGCCUGCGCUUGUAAUAGCUGUCUGCGUGG---- ((((((..((.(((((((.......))).)))).))........))))))....---- ( -18.00, z-score = -0.78, R) >droYak2.chrU 1491395 58 - 28119190 CUGGGCUGCAUGAGCAGUCCAAUUCGCUUAGGUAUGAAAAAGCUGUCCGUGUGGGCAG .((((((((....))))))))....((((..........))))(((((....))))). ( -20.50, z-score = -2.02, R) >droSim1.chrU 1572610 54 - 15797150 ----GUGGGCUGAGCAGUCCAAUUCACUUGGGUAUGCAAAAGCUGCCUGUGUGGGUAG ----.((((((....))))))((((((.((((((.((....)))))))).)))))).. ( -20.90, z-score = -2.23, R) >consensus CUGGGCUGCAUGAGCAGUCCAAUUCGCUUAGGUAUGCAAAAGCUGCCUGUGUGGGCAG ..(((((((....)))))))...((((.((((((.((....)))))))).)))).... ( -9.15 = -9.78 + 0.63)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:50:37 2011