| Sequence ID | dm3.chr3LHet |
|---|---|
| Location | 195,297 – 195,348 |
| Length | 51 |
| Max. P | 0.894982 |
| Location | 195,297 – 195,348 |
|---|---|
| Length | 51 |
| Sequences | 3 |
| Columns | 51 |
| Reading direction | forward |
| Mean pairwise identity | 62.75 |
| Shannon entropy | 0.53351 |
| G+C content | 0.35948 |
| Mean single sequence MFE | -9.43 |
| Consensus MFE | -5.57 |
| Energy contribution | -4.80 |
| Covariance contribution | -0.77 |
| Combinations/Pair | 1.78 |
| Mean z-score | -1.29 |
| Structure conservation index | 0.59 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.12 |
| SVM RNA-class probability | 0.894982 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3LHet 195297 51 + 2555491 UUUAAUGGCCUUAAGCUAUUACAUUAAUCUCCAAAGCGCAAAAAAGCCGCU ..(((((((.....))))))).............(((((......).)))) ( -8.80, z-score = -1.00, R) >dp4.Unknown_group_58 40978 51 + 69560 UUUAGCGGUUUAAAACUGCUGAAUGAGUCUCCGAGGUGCAAAAAGGUCACU (((((((((.....)))))))))..(((..((............))..))) ( -11.10, z-score = -0.74, R) >droMoj3.scaffold_6680 24019109 51 + 24764193 UUUAAUAAUUUAAAGCUAUUCGAAAAAUCUCGAUAGCUCAACAAAAGCUCU .............((((((.(((......)))))))))............. ( -8.40, z-score = -2.13, R) >consensus UUUAAUGGUUUAAAGCUAUUAAAUAAAUCUCCAAAGCGCAAAAAAGCCACU (((((((((.....)))))))))............................ ( -5.57 = -4.80 + -0.77)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:50:09 2011