| Sequence ID | dm3.chr2R |
|---|---|
| Location | 20,368,263 – 20,368,313 |
| Length | 50 |
| Max. P | 0.964323 |
| Location | 20,368,263 – 20,368,313 |
|---|---|
| Length | 50 |
| Sequences | 4 |
| Columns | 50 |
| Reading direction | reverse |
| Mean pairwise identity | 93.67 |
| Shannon entropy | 0.10113 |
| G+C content | 0.61000 |
| Mean single sequence MFE | -23.28 |
| Consensus MFE | -19.90 |
| Energy contribution | -21.15 |
| Covariance contribution | 1.25 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.65 |
| Structure conservation index | 0.85 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.73 |
| SVM RNA-class probability | 0.964323 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 20368263 50 - 21146708 UUUGGCCCCCUGUGCGUGCGUGUUAAUGCACGAAAGCGCAACGGCAGGCG ....(((..((((((((.(((((....)))))...)))).))))..))). ( -22.90, z-score = -2.18, R) >droSim1.chr2R 18827034 50 - 19596830 UUUGGCCCUCUGUGCGUGCGUGUUAAUGCACGAAAGCGCAACGGCAGGCG ....(((..((((((((.(((((....)))))...)))).))))..))). ( -22.80, z-score = -2.34, R) >droSec1.super_23 240833 50 - 989336 UUUGGCCCUCUGUGCGUGCGUGUUAAUGCACGAAAGCGCAACGGCGGGCG ....((((.((((((((.(((((....)))))...)))).)))).)))). ( -27.20, z-score = -3.67, R) >droYak2.chr2R 20331505 50 - 21139217 GUUGGCCCUCUGUGCGUGCGUGUUAAUGCACGAAAGCGCAACGCCGAGAG .(((((....(((((...(((((....)))))...)))))..)))))... ( -20.20, z-score = -2.40, R) >consensus UUUGGCCCUCUGUGCGUGCGUGUUAAUGCACGAAAGCGCAACGGCAGGCG ....((((.((((((((.(((((....)))))...)))).)))).)))). (-19.90 = -21.15 + 1.25)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:48:32 2011