| Sequence ID | dm3.chr2R |
|---|---|
| Location | 20,133,987 – 20,134,046 |
| Length | 59 |
| Max. P | 0.986455 |
| Location | 20,133,987 – 20,134,046 |
|---|---|
| Length | 59 |
| Sequences | 6 |
| Columns | 59 |
| Reading direction | forward |
| Mean pairwise identity | 99.44 |
| Shannon entropy | 0.01102 |
| G+C content | 0.37571 |
| Mean single sequence MFE | -8.80 |
| Consensus MFE | -8.80 |
| Energy contribution | -8.80 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.07 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.45 |
| SVM RNA-class probability | 0.701469 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 20133987 59 + 21146708 ACAAAUCAUAAAUAUUAAUUUUACGACUUAAUUCGACGGCGCAAUAUGCGCUCCCGUUC .................................((..(((((.....)))))..))... ( -8.80, z-score = -1.06, R) >droSec1.super_23 10758 59 + 989336 ACAAAUCAUAAAUAUUAAUUUUACGACUUAAUUCGACGGCGCAAUAUGCGCUCCCGUUC .................................((..(((((.....)))))..))... ( -8.80, z-score = -1.06, R) >droYak2.chr2R 20099957 59 + 21139217 ACAAAUCAUAAAUAUUAAUUUUACGACUUAAUUCGACGGCGCAAUAUGCGCUCCCGUUC .................................((..(((((.....)))))..))... ( -8.80, z-score = -1.06, R) >droEre2.scaffold_4845 21496177 59 + 22589142 ACAAAUCAUAAAUAUUCAUUUUACGACUUAAUUCGACGGCGCAAUAUGCGCUCCCGUUC .................................((..(((((.....)))))..))... ( -8.80, z-score = -1.09, R) >droAna3.scaffold_13266 5609103 59 - 19884421 ACAAAUCAUAAAUAUUAAUUUUACGACUUAAUUCGACGGCGCAAUAUGCGCUCCCGUUC .................................((..(((((.....)))))..))... ( -8.80, z-score = -1.06, R) >droWil1.scaffold_180701 3691247 59 - 3904529 ACAAAUCAUAAAUAUUAAUUUUACGACUUAAUUCGACGGCGCAAUAUGCGCUCCCGUUC .................................((..(((((.....)))))..))... ( -8.80, z-score = -1.06, R) >consensus ACAAAUCAUAAAUAUUAAUUUUACGACUUAAUUCGACGGCGCAAUAUGCGCUCCCGUUC .................................((..(((((.....)))))..))... ( -8.80 = -8.80 + -0.00)
| Location | 20,133,987 – 20,134,046 |
|---|---|
| Length | 59 |
| Sequences | 6 |
| Columns | 59 |
| Reading direction | reverse |
| Mean pairwise identity | 99.44 |
| Shannon entropy | 0.01102 |
| G+C content | 0.37571 |
| Mean single sequence MFE | -16.60 |
| Consensus MFE | -16.60 |
| Energy contribution | -16.60 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.36 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.24 |
| SVM RNA-class probability | 0.986455 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 20133987 59 - 21146708 GAACGGGAGCGCAUAUUGCGCCGUCGAAUUAAGUCGUAAAAUUAAUAUUUAUGAUUUGU ...(((..((((.....))))..)))...(((((((((((.......))))))))))). ( -16.60, z-score = -2.39, R) >droSec1.super_23 10758 59 - 989336 GAACGGGAGCGCAUAUUGCGCCGUCGAAUUAAGUCGUAAAAUUAAUAUUUAUGAUUUGU ...(((..((((.....))))..)))...(((((((((((.......))))))))))). ( -16.60, z-score = -2.39, R) >droYak2.chr2R 20099957 59 - 21139217 GAACGGGAGCGCAUAUUGCGCCGUCGAAUUAAGUCGUAAAAUUAAUAUUUAUGAUUUGU ...(((..((((.....))))..)))...(((((((((((.......))))))))))). ( -16.60, z-score = -2.39, R) >droEre2.scaffold_4845 21496177 59 - 22589142 GAACGGGAGCGCAUAUUGCGCCGUCGAAUUAAGUCGUAAAAUGAAUAUUUAUGAUUUGU ...(((..((((.....))))..)))...(((((((((((.......))))))))))). ( -16.60, z-score = -2.23, R) >droAna3.scaffold_13266 5609103 59 + 19884421 GAACGGGAGCGCAUAUUGCGCCGUCGAAUUAAGUCGUAAAAUUAAUAUUUAUGAUUUGU ...(((..((((.....))))..)))...(((((((((((.......))))))))))). ( -16.60, z-score = -2.39, R) >droWil1.scaffold_180701 3691247 59 + 3904529 GAACGGGAGCGCAUAUUGCGCCGUCGAAUUAAGUCGUAAAAUUAAUAUUUAUGAUUUGU ...(((..((((.....))))..)))...(((((((((((.......))))))))))). ( -16.60, z-score = -2.39, R) >consensus GAACGGGAGCGCAUAUUGCGCCGUCGAAUUAAGUCGUAAAAUUAAUAUUUAUGAUUUGU ...(((..((((.....))))..)))...(((((((((((.......))))))))))). (-16.60 = -16.60 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:47:46 2011