| Sequence ID | dm3.chr2R |
|---|---|
| Location | 19,318,749 – 19,318,864 |
| Length | 115 |
| Max. P | 0.878304 |
| Location | 19,318,749 – 19,318,864 |
|---|---|
| Length | 115 |
| Sequences | 5 |
| Columns | 120 |
| Reading direction | forward |
| Mean pairwise identity | 79.97 |
| Shannon entropy | 0.34449 |
| G+C content | 0.30183 |
| Mean single sequence MFE | -23.85 |
| Consensus MFE | -12.81 |
| Energy contribution | -15.01 |
| Covariance contribution | 2.20 |
| Combinations/Pair | 1.19 |
| Mean z-score | -2.40 |
| Structure conservation index | 0.54 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.03 |
| SVM RNA-class probability | 0.878304 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 19318749 115 + 21146708 CAAAUUAACUGAAUCUAAUUGCUUAGCAUA---UAUUCAAAUAUUUGCUUAGCAAGAACAUAUUGUUCUUAGCCCACUAAACAAAUGCUUUGUUUACAAAUGAUUUGGUUAUAUGUAU-- .....((((..((((.....(((.((((.(---(((....)))).)))).)))((((((.....)))))).......(((((((.....))))))).....))))..)))).......-- ( -26.80, z-score = -3.13, R) >droEre2.scaffold_4845 20685022 100 + 22589142 CAAAUUGUCCGAU----AUAGCUGAGCAUA---UACACAAACAUUUGUUUAGCAGAAACAUAUUGCUCUCAGACCACUAAACAAAUGCUAUGUUUACAAAUGAUUAU------------- ....((((..(((----(((((((.(....---..).))...((((((((((........................)))))))))))))))))).))))........------------- ( -14.66, z-score = -0.33, R) >droYak2.chr2R 19285464 120 + 21139217 CUAAUUAUCCGAAUCUAAUAGCUGAGCAUACAAUAUUCAAAUGUUUGCUUAGCAAGAACAUCUCGCAGCUAGCCCACUAAACAAAUGCUAUGUUUACAUAUGAUUCGCUUAUAAAUAUAU .....((..((((((.....((((((((.(((.........))).))))))))..((((((...(((..(((....)))......))).))))))......))))))..))......... ( -25.10, z-score = -2.40, R) >droSec1.super_9 2608220 111 + 3197100 CAAAUUAGCUGAAUCUAAUUGCUUAGCAUA---UAUUCAAAUAUUUGUUUAGCAGGAACACAUUGUUCUUAGCCCACUAAACAAAUGCUUUGUUUACAAAUGAUUUGGUUAUAC------ .....((((..((((....(((...)))..---((..((((((((((((((((((((((.....)))))).))....)))))))))).))))..)).....))))..))))...------ ( -25.70, z-score = -2.61, R) >droSim1.chr2R 17899470 111 + 19596830 CAAAUUAACUGAAUCUAAUUGCUUAGCAUA---UAUUCAGAUAUUUGCUUAGCAAGAACACAUUGUUCUUAGCCCACUAAACAAAUGCUUUGUUUACAAAUGAUUUGGUUAUAC------ .....((((..((((.....(((.((((.(---(((....)))).)))).)))((((((.....)))))).......(((((((.....))))))).....))))..))))...------ ( -27.00, z-score = -3.53, R) >consensus CAAAUUAACUGAAUCUAAUUGCUUAGCAUA___UAUUCAAAUAUUUGCUUAGCAAGAACAUAUUGUUCUUAGCCCACUAAACAAAUGCUUUGUUUACAAAUGAUUUGGUUAUAC______ .....((((((((((...(((((.((((.................)))).)))))......................(((((((.....))))))).....))))))))))......... (-12.81 = -15.01 + 2.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:45:34 2011