| Sequence ID | dm3.chr2R |
|---|---|
| Location | 19,194,613 – 19,194,663 |
| Length | 50 |
| Max. P | 0.613159 |
| Location | 19,194,613 – 19,194,663 |
|---|---|
| Length | 50 |
| Sequences | 6 |
| Columns | 60 |
| Reading direction | reverse |
| Mean pairwise identity | 77.36 |
| Shannon entropy | 0.40027 |
| G+C content | 0.32382 |
| Mean single sequence MFE | -7.97 |
| Consensus MFE | -7.38 |
| Energy contribution | -7.02 |
| Covariance contribution | -0.36 |
| Combinations/Pair | 1.25 |
| Mean z-score | -0.46 |
| Structure conservation index | 0.93 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.25 |
| SVM RNA-class probability | 0.613159 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 19194613 50 - 21146708 UGUGCGA-AAUAUUAGCAUACAAUAAU-GAAGUGGUUGUUUUCAAAAUAACG-------- (((((..-.......))))).......-......((((((.....)))))).-------- ( -6.50, z-score = -0.23, R) >droEre2.scaffold_4845 20561438 50 - 22589142 UGUGCGA-AAUAUUAGCAUACAAUAAU-GAAGUGGUUGUUUUCAAAACAACG-------- (((((..-.......))))).......-......((((((.....)))))).-------- ( -8.40, z-score = -0.91, R) >droYak2.chr2R 19159477 50 - 21139217 UGUGCAA-AACAUUAGCAUACAAUAAU-GAAGUGGUUGUUUUCAAAACAACG-------- (((((..-.......))))).......-......((((((.....)))))).-------- ( -7.70, z-score = -0.47, R) >droSec1.super_9 2487593 50 - 3197100 UGUGCAA-AAUAUUAGCAUACAAUAAU-GAAGUGGUUGUUUUCAAAACAACG-------- (((((..-.......))))).......-......((((((.....)))))).-------- ( -7.70, z-score = -0.72, R) >droSim1.chr2R 17778017 51 - 19596830 UGUGCCA-AAUAUUAGCAUACAAUAAUCAAGGGGGUUGUUUUCAAAACAACG-------- (((((..-.......)))))..............((((((.....)))))).-------- ( -7.20, z-score = -0.68, R) >droWil1.scaffold_180699 175565 60 - 2593675 UGUGCAAUGAAAUUUGCAUAAAAUGAUUCAAAAUGUAGCAGCAGCAGCAACAACAAAUGG (((((((......))))))).............(((.((....)).)))........... ( -10.30, z-score = 0.25, R) >consensus UGUGCAA_AAUAUUAGCAUACAAUAAU_GAAGUGGUUGUUUUCAAAACAACG________ (((((..........)))))..............(((((((...)))))))......... ( -7.38 = -7.02 + -0.36)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:45:18 2011