| Sequence ID | dm3.chr2R |
|---|---|
| Location | 19,042,718 – 19,042,783 |
| Length | 65 |
| Max. P | 0.963396 |
| Location | 19,042,718 – 19,042,783 |
|---|---|
| Length | 65 |
| Sequences | 8 |
| Columns | 65 |
| Reading direction | reverse |
| Mean pairwise identity | 88.35 |
| Shannon entropy | 0.23548 |
| G+C content | 0.33743 |
| Mean single sequence MFE | -13.72 |
| Consensus MFE | -11.97 |
| Energy contribution | -12.36 |
| Covariance contribution | 0.39 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.07 |
| Structure conservation index | 0.87 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.72 |
| SVM RNA-class probability | 0.963396 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 19042718 65 - 21146708 CGCGCUGGUGGGCGGUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGAGAAAUAAUUUAAUGC ....((.((.((((((((((((((....))))))))))))))....)).)).............. ( -16.10, z-score = -2.91, R) >droSim1.chr2R 17625217 65 - 19596830 CGCGCUGGUGGGCGGUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGAGAAAUAAUUUAAUGC ....((.((.((((((((((((((....))))))))))))))....)).)).............. ( -16.10, z-score = -2.91, R) >droSec1.super_9 2337142 65 - 3197100 CGCGCUGGUGGGCGGUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGAGAAAUAAUUUAAUGC ....((.((.((((((((((((((....))))))))))))))....)).)).............. ( -16.10, z-score = -2.91, R) >droYak2.chr2R 19006363 65 - 21139217 CGCGCUGGUGGGCGGUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGAGAAAUAAUUUAAUGC ....((.((.((((((((((((((....))))))))))))))....)).)).............. ( -16.10, z-score = -2.91, R) >droEre2.scaffold_4845 20409761 65 - 22589142 CGCGCUGGUGGGCGGUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGAGAAAUAAUUUAAUGC ....((.((.((((((((((((((....))))))))))))))....)).)).............. ( -16.10, z-score = -2.91, R) >droAna3.scaffold_13266 8139778 65 + 19884421 CCUGCUCCUGGGCGGUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGGGAAAUAAUUUAAUGC .....((((.((((((((((((((....))))))))))))))......))))............. ( -16.60, z-score = -3.00, R) >droVir3.scaffold_12875 17597151 61 + 20611582 ----CAACAAUGCGCUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGCGCCAUAAUUUAAUGU ----.......((((.(((......))).(((((.....)))))....))))............. ( -8.00, z-score = 0.09, R) >droMoj3.scaffold_6496 22178134 64 - 26866924 -CAACAACAAUACGCUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGCGCCAUAAUUUAAUGU -..........(((.(((((((((....))))))))).)))........................ ( -4.70, z-score = 0.88, R) >consensus CGCGCUGGUGGGCGGUUUGUUAAAUCAAUUUGAUAAACUGUCAAUAAUGAGAAAUAAUUUAAUGC ..........((((((((((((((....))))))))))))))....................... (-11.97 = -12.36 + 0.39)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:44:57 2011