Sequence ID | dm3.chr2R |
---|---|
Location | 18,457,197 – 18,457,250 |
Length | 53 |
Max. P | 0.720677 |
Location | 18,457,197 – 18,457,250 |
---|---|
Length | 53 |
Sequences | 6 |
Columns | 59 |
Reading direction | forward |
Mean pairwise identity | 63.06 |
Shannon entropy | 0.61355 |
G+C content | 0.37941 |
Mean single sequence MFE | -12.10 |
Consensus MFE | -3.00 |
Energy contribution | -3.53 |
Covariance contribution | 0.53 |
Combinations/Pair | 1.33 |
Mean z-score | -2.32 |
Structure conservation index | 0.25 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.42 |
SVM RNA-class probability | 0.686522 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 18457197 53 + 21146708 -----AAACAACAUUUCUUAAUG-AGCACGUGUAGAGUGAAUCUACACCUGUUCUCUAC -----.................(-((((.(((((((.....))))))).)))))..... ( -15.50, z-score = -3.62, R) >droPer1.super_2 7272516 52 + 9036312 AAAUCAGGUUGAACCGUGUAAAAUAACACAAACAGAAUGUA---ACAUCUGUUAC---- ......((.....))((((......)))).((((((.....---...))))))..---- ( -10.00, z-score = -1.69, R) >dp4.chr3 7072950 52 + 19779522 AAAUCAGGUAGAACCGUGUAAAAUAACACAAACAGAAUGUA---ACAUCUGUUAC---- ......((.....))((((......)))).((((((.....---...))))))..---- ( -10.00, z-score = -2.15, R) >droEre2.scaffold_4845 15097492 53 - 22589142 -----GAACAACAUCUCUUAAUG-AGCACGUGUAAAGUGAGUCUACACCUGUUCUCUGC -----.................(-((((.(((((.........))))).)))))..... ( -9.60, z-score = -0.43, R) >droYak2.chr2R 15926391 53 + 21139217 -----AAACAACAUCUCUUAAUG-AGCACGUGUAAAGUGAGUCUACACCUGUUCUCUAC -----.................(-((((.(((((.........))))).)))))..... ( -9.60, z-score = -1.13, R) >droSim1.chr2R 17047063 53 + 19596830 -----AAACAACAUCUCUUAAUG-AGCACGUGUAGAGUGAAUCUACACCUGCUCUCUAC -----.................(-((((.(((((((.....))))))).)))))..... ( -17.90, z-score = -4.89, R) >consensus _____AAACAACAUCUCUUAAUG_AGCACGUGUAGAGUGAAUCUACACCUGUUCUCUAC ........................((((.(((((.........))))).))))...... ( -3.00 = -3.53 + 0.53)
Location | 18,457,197 – 18,457,250 |
---|---|
Length | 53 |
Sequences | 6 |
Columns | 59 |
Reading direction | reverse |
Mean pairwise identity | 63.06 |
Shannon entropy | 0.61355 |
G+C content | 0.37941 |
Mean single sequence MFE | -12.67 |
Consensus MFE | -4.95 |
Energy contribution | -5.28 |
Covariance contribution | 0.34 |
Combinations/Pair | 1.44 |
Mean z-score | -1.51 |
Structure conservation index | 0.39 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.50 |
SVM RNA-class probability | 0.720677 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 18457197 53 - 21146708 GUAGAGAACAGGUGUAGAUUCACUCUACACGUGCU-CAUUAAGAAAUGUUGUUU----- ...(((..((.(((((((.....))))))).))))-).................----- ( -13.70, z-score = -1.88, R) >droPer1.super_2 7272516 52 - 9036312 ----GUAACAGAUGU---UACAUUCUGUUUGUGUUAUUUUACACGGUUCAACCUGAUUU ----..((((((...---.....)))))).((((......))))((.....))...... ( -9.70, z-score = -1.11, R) >dp4.chr3 7072950 52 - 19779522 ----GUAACAGAUGU---UACAUUCUGUUUGUGUUAUUUUACACGGUUCUACCUGAUUU ----..((((((...---.....)))))).((((......))))((.....))...... ( -9.70, z-score = -1.35, R) >droEre2.scaffold_4845 15097492 53 + 22589142 GCAGAGAACAGGUGUAGACUCACUUUACACGUGCU-CAUUAAGAGAUGUUGUUC----- .....(((((((((((((.....)))))))...((-(.....)))...))))))----- ( -12.00, z-score = -0.51, R) >droYak2.chr2R 15926391 53 - 21139217 GUAGAGAACAGGUGUAGACUCACUUUACACGUGCU-CAUUAAGAGAUGUUGUUU----- ...(((..((.(((((((.....))))))).))))-).................----- ( -11.00, z-score = -0.41, R) >droSim1.chr2R 17047063 53 - 19596830 GUAGAGAGCAGGUGUAGAUUCACUCUACACGUGCU-CAUUAAGAGAUGUUGUUU----- .....(((((.(((((((.....))))))).))))-).................----- ( -19.90, z-score = -3.78, R) >consensus GUAGAGAACAGGUGUAGAUUCACUCUACACGUGCU_CAUUAAGAGAUGUUGUUU_____ ........((.(((((((.....))))))).)).......................... ( -4.95 = -5.28 + 0.34)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:43:38 2011