| Sequence ID | dm3.chr2R |
|---|---|
| Location | 18,181,293 – 18,181,352 |
| Length | 59 |
| Max. P | 0.537656 |
| Location | 18,181,293 – 18,181,352 |
|---|---|
| Length | 59 |
| Sequences | 8 |
| Columns | 60 |
| Reading direction | reverse |
| Mean pairwise identity | 60.49 |
| Shannon entropy | 0.80434 |
| G+C content | 0.36455 |
| Mean single sequence MFE | -9.10 |
| Consensus MFE | -3.66 |
| Energy contribution | -3.85 |
| Covariance contribution | 0.19 |
| Combinations/Pair | 1.33 |
| Mean z-score | -0.58 |
| Structure conservation index | 0.40 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.09 |
| SVM RNA-class probability | 0.537656 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2R 18181293 59 - 21146708 UUUUUUCACUUGCUUUUUGCUUUUGCUUAAACGCAAUUUAAAAUUGCGACGAUUU-CAAG ........((((.(((..((....))..)))((((((.....)))))).......-)))) ( -9.10, z-score = -1.10, R) >droSim1.chr2R 16777956 59 - 19596830 UUUUGUCCCUUGCUUUUUGCUUUUGCUUGAACGCAAUUUGAAAUUGCGACGGUUU-UAAG ......((.((((..(((.(..((((......))))...))))..)))).))...-.... ( -10.10, z-score = -0.74, R) >droYak2.chr2R 17932518 54 - 21139217 -----AUUUGCCAUCCGGGCUUUUGCUUGAACGCAAUUUGAAAUUGCGACGAUUUGAAG- -----..........(((((....)))))..((((((.....))))))...........- ( -11.40, z-score = -0.83, R) >droEre2.scaffold_4845 12322075 52 - 22589142 -----UUUUGCCAUCC-GGCUUUGGCUUGAACGCAAUUUGAAAUUGCGACGA-UUGAAG- -----((..((((...-.....))))..)).((((((.....))))))....-......- ( -11.80, z-score = -1.08, R) >droAna3.scaffold_13266 2196925 53 - 19884421 -----UGUUGUC-UCUGGACUUUUGGUUAAACGCAGUUUAAAAUUGCGUCGAUUCCAGG- -----.......-.(((((...(((.....(((((((.....)))))))))).))))).- ( -12.90, z-score = -1.82, R) >dp4.chr3 4825891 60 + 19779522 UAUUCUUAUUUAAAAUGCUUUUGUGUUCUGUUCCACUUCGAAAUUGCGACGAUUUGUAAG ...............(((..((((((....(((......)))...)).))))...))).. ( -4.70, z-score = 0.61, R) >droPer1.super_4 4098051 60 - 7162766 UAUUCUUAUUUAAACUGCUUUUGUGUUCUGUUCCAGUUCGAAAUUGCGACGAUUUGUAAG ....(((((......(((..((.((..(((...)))..)).))..))).......))))) ( -6.12, z-score = 0.32, R) >droVir3.scaffold_10324 677538 59 - 1288806 UUUUUUUACAUAUAUUUGAUUUUAGCUUAUACGCAUUUGGUAAUUGCGUCGCUUUAGCC- ........................(((...(((((.........)))))......))).- ( -6.70, z-score = -0.02, R) >consensus U_UU_UUAUUUAAUCUGGGCUUUUGCUUAAACGCAAUUUGAAAUUGCGACGAUUUGAAA_ ...............................((((((.....))))))............ ( -3.66 = -3.85 + 0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 22:42:50 2011